MD13G1126200.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Forward (+)
9396696 .. 9398640
1945 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1126200.v1.1.491

Sequence Viewer

Length: 180 bp
ATGGGATCTCACGCCATTTTCCACCAGGATAAGAGGTTCTTAATTAAGGAACTCTCCAGGAAGAAGAAGGATATTCGATTTCCTCTGGAGCAAAACATGATGAAACGAACAAATTTTGGAGTGATTCAAATTGGAGGACGTTCATGTGTCTCTCAACTTGTTCATGTCAAAGTTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.87

Weight (kDa)

10.68

Isoelectric Point (pI)

40.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020355)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 13
AcsI RAATTY 1 cut(s) 112
AgsI TTSAA 1 cut(s) 128
AjnI CCWGG 2 cut(s) 24, 56
AloI GAACNNNNNNTCC 2 cut(s) 20, 52
Alw26I GTCTC 1 cut(s) 154
AlwI GGATC 1 cut(s) 13
ApoI RAATTY 1 cut(s) 112
BciT130I CCWGG 2 cut(s) 26, 58
BcoDI GTCTC 1 cut(s) 154
Bme1390I CCNGG 2 cut(s) 26, 58
BmrFI CCNGG 2 cut(s) 26, 58
BpmI CTGGAG 2 cut(s) 40, 107
BseBI CCWGG 2 cut(s) 26, 58
BsmAI GTCTC 1 cut(s) 154
Bsp143I GATC 1 cut(s) 5
BspPI GGATC 1 cut(s) 13
BssMI GATC 1 cut(s) 5
Bst2UI CCWGG 2 cut(s) 26, 58
BstKTI GATC 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 154
BstMBI GATC 1 cut(s) 5
BstNI CCWGG 2 cut(s) 26, 58
BstSCI CCNGG 2 cut(s) 24, 56
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
CviAII CATG 3 cut(s) 97, 144, 164
DpnI GATC 1 cut(s) 7
DpnII GATC 1 cut(s) 5
EcoRII CCWGG 2 cut(s) 24, 56
FaeI CATG 3 cut(s) 100, 147, 167
FaiI YATR 4 cut(s) 98, 145, 165, 178
FalI AAGNNNNNCTT 2 cut(s) 23, 55
FatI CATG 3 cut(s) 96, 143, 163
GsuI CTGGAG 2 cut(s) 40, 107
Hin1II CATG 3 cut(s) 100, 147, 167
HinfI GANTC 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 86
HpyAV CCTTC 1 cut(s) 61
HpyCH4IV ACGT 1 cut(s) 139
HpySE526I ACGT 1 cut(s) 139
Hsp92II CATG 3 cut(s) 100, 147, 167
Kzo9I GATC 1 cut(s) 5
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 5 cut(s) 11, 38, 43, 70, 71
MaeII ACGT 1 cut(s) 139
MalI GATC 1 cut(s) 7
MboI GATC 1 cut(s) 5
MboII GAAGA 2 cut(s) 73, 76
MflI RGATCY 1 cut(s) 5
MluCI AATT 3 cut(s) 42, 112, 129
MnlI CCTC 3 cut(s) 27, 93, 128
MseI TTAA 2 cut(s) 41, 45
MspR9I CCNGG 2 cut(s) 26, 58
MvaI CCWGG 2 cut(s) 26, 58
NdeII GATC 1 cut(s) 5
NlaIII CATG 3 cut(s) 100, 147, 167
PacI TTAATTAA 1 cut(s) 45
PfeI GAWTC 1 cut(s) 124
PfoI TCCNGGA 1 cut(s) 56
Psp6I CCWGG 2 cut(s) 24, 56
PspGI CCWGG 2 cut(s) 24, 56
PsuI RGATCY 1 cut(s) 5
SaqAI TTAA 2 cut(s) 41, 45
Sau3AI GATC 1 cut(s) 5
ScrFI CCNGG 2 cut(s) 26, 58
SetI ASST 2 cut(s) 38, 142
Sse9I AATT 3 cut(s) 42, 112, 129
StyD4I CCNGG 2 cut(s) 24, 56
TaiI ACGT 1 cut(s) 142
TaqI TCGA 1 cut(s) 76
TasI AATT 3 cut(s) 42, 112, 129
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 2 cut(s) 41, 45
Tru9I TTAA 2 cut(s) 41, 45
TspDTI ATGAA 4 cut(s) 116, 132, 152, 165
XapI RAATTY 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.