MD15G1041600.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
2911240 .. 2914467
3228 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1041600.v1.1.491

Sequence Viewer

Length: 228 bp
ATGGCTTCGTACCGTGTAGATTCTATAGATGATGCAATTGATTTGGAATATGAATCGGGGGGAAGTAAATGTGAGGCCGAAAGTGAAGGAGATCAAGAGGAGGTATCGAAGAGATCCACCCTATCCAAAAACCAGAGACAGCGAGAGAGAGTGGCATTGAATTGCACCACTATTTCGCCTCTCCGTCCTCCCTCTCTGTGTCCGTCATGTCGTCGACCAGTGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.36

Weight (kDa)

5.07

Isoelectric Point (pI)

79.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020355)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 214
AclWI GGATC 1 cut(s) 108
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 130
AlwI GGATC 1 cut(s) 108
AoxI GGCC 1 cut(s) 75
BcoDI GTCTC 1 cut(s) 130
BfmI CTRYAG 1 cut(s) 24
BmsI GCATC 1 cut(s) 22
Bse1I ACTGG 1 cut(s) 218
BseNI ACTGG 1 cut(s) 218
BseRI GAGGAG 1 cut(s) 113
BshFI GGCC 1 cut(s) 77
BsmAI GTCTC 1 cut(s) 130
BsnI GGCC 1 cut(s) 77
Bsp143I GATC 2 cut(s) 91, 113
BspANI GGCC 1 cut(s) 77
BspPI GGATC 1 cut(s) 108
BsrI ACTGG 1 cut(s) 218
BssMI GATC 2 cut(s) 91, 113
Bst4CI ACNGT 1 cut(s) 14
Bst6I CTCTTC 1 cut(s) 104
BstKTI GATC 2 cut(s) 94, 116
BstMAI GTCTC 1 cut(s) 130
BstMBI GATC 2 cut(s) 91, 113
BstSFI CTRYAG 1 cut(s) 24
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BsuRI GGCC 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 225
Csp6I GTAC 1 cut(s) 10
CviAII CATG 1 cut(s) 207
CviJI RGCY 2 cut(s) 5, 77
CviKI_1 RGCY 2 cut(s) 5, 77
CviQI GTAC 1 cut(s) 10
DpnI GATC 2 cut(s) 93, 115
DpnII GATC 2 cut(s) 91, 113
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
FaeI CATG 1 cut(s) 210
FaiI YATR 3 cut(s) 26, 51, 208
FatI CATG 1 cut(s) 206
FblI GTMKAC 1 cut(s) 214
HaeIII GGCC 1 cut(s) 77
Hin1II CATG 1 cut(s) 210
HincII GTYRAC 1 cut(s) 215
HindII GTYRAC 1 cut(s) 215
HinfI GANTC 2 cut(s) 20, 53
Hpy166II GTNNAC 1 cut(s) 215
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 215
Hpy99I CGWCG 1 cut(s) 216
HpyAV CCTTC 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 14
HpyCH4V TGCA 2 cut(s) 35, 165
Hsp92II CATG 1 cut(s) 210
Kzo9I GATC 2 cut(s) 91, 113
LpnPI CCDG 1 cut(s) 146
LweI GCATC 1 cut(s) 22
MalI GATC 2 cut(s) 93, 115
MboI GATC 2 cut(s) 91, 113
MboII GAAGA 1 cut(s) 121
MfeI CAATTG 1 cut(s) 36
MflI RGATCY 1 cut(s) 113
MluCI AATT 2 cut(s) 36, 160
MnlI CCTC 6 cut(s) 67, 91, 94, 189, 198, 202
MseI TTAA 1 cut(s) 226
MunI CAATTG 1 cut(s) 36
NdeII GATC 2 cut(s) 91, 113
NlaIII CATG 1 cut(s) 210
PfeI GAWTC 2 cut(s) 20, 53
PsuI RGATCY 1 cut(s) 113
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SalI GTCGAC 1 cut(s) 213
SaqAI TTAA 1 cut(s) 226
Sau3AI GATC 2 cut(s) 91, 113
SetI ASST 1 cut(s) 105
SfaNI GCATC 1 cut(s) 22
SfcI CTRYAG 1 cut(s) 24
SgeI CNNG 6 cut(s) 26, 69, 107, 145, 155, 219
Sse9I AATT 2 cut(s) 36, 160
TaaI ACNGT 1 cut(s) 14
TaqI TCGA 2 cut(s) 107, 214
TasI AATT 2 cut(s) 36, 160
TfiI GAWTC 2 cut(s) 20, 53
Tru1I TTAA 1 cut(s) 226
Tru9I TTAA 1 cut(s) 226
TscAI CASTG 1 cut(s) 225
TspDTI ATGAA 1 cut(s) 66
TspGWI ACGGA 2 cut(s) 173, 192
TspRI CASTG 1 cut(s) 225
XmiI GTMKAC 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.