MD15G1197600.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0020355
Physical Location & Seq
Reverse (-)
15694797 .. 15696060
1264 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1197600.v1.1.491

Sequence Viewer

Length: 162 bp
ATGTATTTTATTCTTTTCTTAGTATGTTTTGGTAATTATTTCGATAGAATTTTTTTACTTTGCTTTATATTTTCAATACAGGACATTCAACTTTCTCTAGAGCAAAACATGATCAAACGGATGAATTTTGGAGTGATTCTAATTGGAGGATGTTTGTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.35

Weight (kDa)

5.87

Isoelectric Point (pI)

40.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020355)

Species Orthologous Gene IDs
malus_domestica MD08G1025600.v1.1 MD13G1126200.v1.1 MD15G1041600.v1.1 MD15G1197600.v1.1 MD17G1135200.v1.1
pyrus_communis pycom12g08950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 48, 124
AgsI TTSAA 2 cut(s) 75, 89
ApoI RAATTY 2 cut(s) 48, 124
BclI TGATCA 1 cut(s) 111
BfaI CTAG 1 cut(s) 98
BseGI GGATG 2 cut(s) 126, 155
Bsp143I GATC 1 cut(s) 111
BssMI GATC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 19
BstF5I GGATG 2 cut(s) 126, 155
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BtsCI GGATG 2 cut(s) 126, 155
CviAII CATG 1 cut(s) 109
DdeI CTNAG 1 cut(s) 19
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
FaeI CATG 1 cut(s) 112
FaiI YATR 3 cut(s) 25, 68, 110
FatI CATG 1 cut(s) 108
FbaI TGATCA 1 cut(s) 111
FokI GGATG 1 cut(s) 133
FspBI CTAG 1 cut(s) 98
FspEI CC 7 cut(s) 15, 65, 103, 114, 129, 132, 142
Hin1II CATG 1 cut(s) 112
HinfI GANTC 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 98
HpyF3I CTNAG 1 cut(s) 19
Hsp92II CATG 1 cut(s) 112
Ksp22I TGATCA 1 cut(s) 111
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 1 cut(s) 65
MaeI CTAG 1 cut(s) 98
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MluCI AATT 4 cut(s) 34, 48, 124, 141
MnlI CCTC 1 cut(s) 140
NdeII GATC 1 cut(s) 111
NlaIII CATG 1 cut(s) 112
PfeI GAWTC 1 cut(s) 136
Sau3AI GATC 1 cut(s) 111
SgeI CNNG 3 cut(s) 92, 110, 121
Sse9I AATT 4 cut(s) 34, 48, 124, 141
SspMI CTAG 1 cut(s) 98
TaqI TCGA 1 cut(s) 42
TasI AATT 4 cut(s) 34, 48, 124, 141
TfiI GAWTC 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 137
TspGWI ACGGA 1 cut(s) 133
XapI RAATTY 2 cut(s) 48, 124
XbaI TCTAGA 1 cut(s) 97
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.