MD17G1135200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0020355
Physical Location & Seq
Forward (+)
12108347 .. 12119322
10976 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1135200.v1.1.491

Sequence Viewer

Length: 180 bp
ATGGCTTCGGATTATGTAGATTCTGTAGAGGATGCAATTGATTTGGAATATGAATCGGGGGGAAGCAAAAGAGAGACCGAAAGTGAAGGCGATCAAGAGGAGGACTTTCAACTTTCTTTGGAGCAAAACATGGTCAAATGGAGGAATTTTGGAGTAATTCCAGTTGAAGGACGTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.7

Weight (kDa)

4.05

Isoelectric Point (pI)

58.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020355)

Species Orthologous Gene IDs
malus_domestica MD08G1025600.v1.1 MD13G1126200.v1.1 MD15G1041600.v1.1 MD15G1197600.v1.1 MD17G1135200.v1.1
pyrus_communis pycom12g08950

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 145
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 2 cut(s) 110, 167
Alw26I GTCTC 1 cut(s) 68
ApoI RAATTY 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 68
BfmI CTRYAG 1 cut(s) 24
BmsI GCATC 1 cut(s) 22
BsaI GGTCTC 1 cut(s) 68
Bsc4I CCNNNNNNNGG 1 cut(s) 167
Bse1I ACTGG 1 cut(s) 161
BseGI GGATG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 167
BseNI ACTGG 1 cut(s) 161
BseRI GAGGAG 1 cut(s) 113
BslI CCNNNNNNNGG 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 68
Bso31I GGTCTC 1 cut(s) 68
Bsp143I GATC 1 cut(s) 91
BspHI TCATGA 1 cut(s) 176
BspTNI GGTCTC 1 cut(s) 68
BsrI ACTGG 1 cut(s) 161
BssMI GATC 1 cut(s) 91
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 68
BstMBI GATC 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 24
BtsCI GGATG 1 cut(s) 37
CciI TCATGA 1 cut(s) 176
CviAII CATG 2 cut(s) 130, 177
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco31I GGTCTC 1 cut(s) 68
FaeI CATG 2 cut(s) 133, 180
FaiI YATR 4 cut(s) 15, 51, 131, 178
FatI CATG 2 cut(s) 129, 176
FokI GGATG 1 cut(s) 44
Hin1II CATG 2 cut(s) 133, 180
HinfI GANTC 2 cut(s) 20, 53
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 2 cut(s) 95, 177
HpyAV CCTTC 2 cut(s) 80, 161
HpyCH4IV ACGT 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 35
HpySE526I ACGT 1 cut(s) 172
Hsp92II CATG 2 cut(s) 133, 180
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 1 cut(s) 174
LweI GCATC 1 cut(s) 22
MaeII ACGT 1 cut(s) 172
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MfeI CAATTG 1 cut(s) 36
MluCI AATT 3 cut(s) 36, 145, 156
MnlI CCTC 4 cut(s) 22, 91, 94, 135
MunI CAATTG 1 cut(s) 36
NdeII GATC 1 cut(s) 91
NlaIII CATG 2 cut(s) 133, 180
PagI TCATGA 1 cut(s) 176
PfeI GAWTC 2 cut(s) 20, 53
Sau3AI GATC 1 cut(s) 91
SetI ASST 1 cut(s) 175
SfaNI GCATC 1 cut(s) 22
SfcI CTRYAG 1 cut(s) 24
SgeI CNNG 4 cut(s) 69, 107, 142, 173
Sse9I AATT 3 cut(s) 36, 145, 156
TaiI ACGT 1 cut(s) 175
TaqII GACCGA 1 cut(s) 92
TasI AATT 3 cut(s) 36, 145, 156
TfiI GAWTC 2 cut(s) 20, 53
TspDTI ATGAA 2 cut(s) 66, 165
XapI RAATTY 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.