MD15G1066100.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
4595773 .. 4596096
324 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1066100.v1.1.491

Sequence Viewer

Length: 324 bp
ATGGCCACCACATGCTCCAGCTTCTTCAGTTTCCGGTCAAGTAGTTCTTCCGTCGAGCCCAAACTCCGGTCCTCGTCGAGCGGCTCATCACACGGCTGTAGCAAGGTTGATGGGGTGGCTATGTGGCTCATGCACAGTGTCAGTTATGCTTTCTTTGCATCTTTAGAAAGGTGCTCTTGCATCCGTATCATTACTCAAGAAGACGGCGATGATTGTAACGACCTGCCGTTGATTTTGAACGATGGGAATTTCCGGCATGAGGTTGTTGATCACTCCACCACCAGCCGGAGAAGAACAGGCAAAGGAAAGAAGGGTACGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

11.75

Weight (kDa)

8.35

Isoelectric Point (pI)

59.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016274)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g32740
malus_domestica MD15G1066100.v1.1
prunus_persica Prupe.1G419900_v2.0.a1
pyrus_communis pycom08g06540 pycom15g06240
rosa_chinensis RchiOBHm_Chr6g0309931
rosa_laevigata RLG00000010523
rosa_multiflora Rmu_co8261055.1_g000001
rosa_roxburghii Rroxscaffold_7G00159030
rosa_rugosa Rorug06G0376000
rosa_samantha Rh6AG489900 Rh6BG499300 Rh6CG504200 Rh6DG490400
rosa_wichuraiana Rw6G042640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 231
AccBSI CCGCTC 1 cut(s) 81
AciI CCGC 1 cut(s) 81
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 247
AcuI CTGAAG 1 cut(s) 10
AfaI GTAC 2 cut(s) 316, 320
AfiI CCNNNNNNNGG 3 cut(s) 66, 259, 285
AgsI TTSAA 1 cut(s) 238
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
Alw21I GWGCWC 1 cut(s) 176
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 247
AspS9I GGNCC 1 cut(s) 69
AvaII GGWCC 1 cut(s) 69
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 60
BarI GAAGNNNNNNTAC 1 cut(s) 302
BbsI GAAGAC 1 cut(s) 207
Bbv12I GWGCWC 1 cut(s) 176
BccI CCATC 2 cut(s) 104, 236
BceAI ACGGC 3 cut(s) 109, 211, 220
BclI TGATCA 1 cut(s) 268
BfaI CTAG 1 cut(s) 322
BfmI CTRYAG 1 cut(s) 97
BfuAI ACCTGC 1 cut(s) 231
BisI GCNGC 1 cut(s) 82
BlsI GCNGC 1 cut(s) 83
Bme18I GGWCC 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 69
BmsI GCATC 2 cut(s) 167, 189
BpiI GAAGAC 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 180
BsaAI YACGTR 1 cut(s) 318
BsaWI WCCGGW 2 cut(s) 33, 66
Bsc4I CCNNNNNNNGG 3 cut(s) 66, 259, 285
BseGI GGATG 1 cut(s) 180
BseLI CCNNNNNNNGG 3 cut(s) 66, 259, 285
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 176
BsiSI CCGG 4 cut(s) 34, 67, 253, 286
BslI CCNNNNNNNGG 3 cut(s) 66, 259, 285
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 2 cut(s) 60, 176
Bsp143I GATC 1 cut(s) 268
BspACI CCGC 1 cut(s) 81
BspANI GGCC 1 cut(s) 5
BspMI ACCTGC 1 cut(s) 231
BsrBI CCGCTC 1 cut(s) 81
BssMI GATC 1 cut(s) 268
Bst4CI ACNGT 1 cut(s) 137
BstBAI YACGTR 1 cut(s) 318
BstF5I GGATG 1 cut(s) 180
BstKTI GATC 1 cut(s) 271
BstMBI GATC 1 cut(s) 268
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNSI RCATGY 1 cut(s) 15
BstSFI CTRYAG 1 cut(s) 97
BstSNI TACGTA 1 cut(s) 318
BstV2I GAAGAC 1 cut(s) 207
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 1 cut(s) 222
BtsCI GGATG 1 cut(s) 180
BtsIMutI CAGTG 1 cut(s) 142
BveI ACCTGC 1 cut(s) 231
Cfr13I GGNCC 1 cut(s) 69
Csp6I GTAC 2 cut(s) 315, 319
CviAII CATG 3 cut(s) 12, 130, 257
CviJI RGCY 8 cut(s) 5, 21, 58, 84, 96, 119, 127, 285
CviKI_1 RGCY 8 cut(s) 5, 21, 58, 84, 96, 119, 127, 285
CviQI GTAC 2 cut(s) 315, 319
DpnI GATC 1 cut(s) 270
DpnII GATC 1 cut(s) 268
EaeI YGGCCR 1 cut(s) 3
Eco105I TACGTA 1 cut(s) 318
Eco24I GRGCYC 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 69
Eco57I CTGAAG 1 cut(s) 10
EcoT38I GRGCYC 1 cut(s) 60
FaeI CATG 3 cut(s) 15, 133, 260
FaiI YATR 5 cut(s) 13, 122, 131, 147, 258
FalI AAGNNNNNCTT 4 cut(s) 31, 63, 160, 192
FatI CATG 3 cut(s) 11, 129, 256
FbaI TGATCA 1 cut(s) 268
Fnu4HI GCNGC 1 cut(s) 82
FokI GGATG 1 cut(s) 167
FriOI GRGCYC 1 cut(s) 60
Fsp4HI GCNGC 1 cut(s) 82
FspBI CTAG 1 cut(s) 322
GluI GCNGC 1 cut(s) 82
HaeIII GGCC 1 cut(s) 5
HapII CCGG 4 cut(s) 34, 67, 253, 286
Hin1II CATG 3 cut(s) 15, 133, 260
HpaII CCGG 4 cut(s) 34, 67, 253, 286
Hpy188III TCNNGA 1 cut(s) 197
Hpy99I CGWCG 2 cut(s) 56, 79
HpyAV CCTTC 1 cut(s) 304
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4IV ACGT 1 cut(s) 317
HpyCH4V TGCA 3 cut(s) 133, 158, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 317
Hsp92II CATG 3 cut(s) 15, 133, 260
Ksp22I TGATCA 1 cut(s) 268
Kzo9I GATC 1 cut(s) 268
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 8 cut(s) 31, 47, 80, 236, 266, 282, 295, 299
LweI GCATC 2 cut(s) 167, 189
MaeI CTAG 1 cut(s) 322
MaeII ACGT 1 cut(s) 317
MaeIII GTNAC 1 cut(s) 215
MalI GATC 1 cut(s) 270
MbiI CCGCTC 1 cut(s) 81
MboI GATC 1 cut(s) 268
MboII GAAGA 4 cut(s) 16, 39, 212, 303
MhlI GDGCHC 2 cut(s) 60, 176
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 247
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 82, 253
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 4 cut(s) 34, 67, 253, 286
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 1 cut(s) 268
NlaIII CATG 3 cut(s) 15, 133, 260
NspI RCATGY 1 cut(s) 15
PkrI GCNGC 1 cut(s) 83
Ppu21I YACGTR 1 cut(s) 318
PspPI GGNCC 1 cut(s) 69
RsaI GTAC 2 cut(s) 316, 320
RsaNI GTAC 2 cut(s) 315, 319
SatI GCNGC 1 cut(s) 82
Sau3AI GATC 1 cut(s) 268
Sau96I GGNCC 1 cut(s) 69
SduI GDGCHC 2 cut(s) 60, 176
SetI ASST 6 cut(s) 23, 108, 173, 225, 264, 320
SfaNI GCATC 2 cut(s) 167, 189
SfcI CTRYAG 1 cut(s) 97
SinI GGWCC 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 195
SmoI CTYRAG 1 cut(s) 195
SnaBI TACGTA 1 cut(s) 318
Sse9I AATT 1 cut(s) 247
SsiI CCGC 1 cut(s) 81
SspMI CTAG 1 cut(s) 322
TaaI ACNGT 1 cut(s) 137
TaiI ACGT 1 cut(s) 320
TaqI TCGA 2 cut(s) 54, 77
TasI AATT 1 cut(s) 247
TauI GCSGC 1 cut(s) 84
TscAI CASTG 1 cut(s) 142
TspGWI ACGGA 2 cut(s) 40, 173
TspRI CASTG 1 cut(s) 142
VpaK11BI GGWCC 1 cut(s) 69
XapI RAATTY 1 cut(s) 247
XceI RCATGY 1 cut(s) 15
XspI CTAG 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.