Prupe.1G419900_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
36345583 .. 36345921
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G419900.1

Sequence Viewer

Length: 339 bp
ATGGCCACCACCACCTCCTCCTCCAACTTCTTCAATCTCCGGTCAACTACTACTTCAGTCCACCCCAAGTCCCGGCCCTTGTCGAGCAACGGCTCATCGCACGGTTGTGGCAAGGTTGATGGGGTGGCTATGTGGCTCATTAACAGTGTCACAACTTGTTTCTTTGCATCCTTAGAGAGGTGCTCTTGCATCCGTATCGCCACGCAAGATGACGGCGATGACTGCAACGACTTGCCATTGATTTTTAACGACGGGAATCTTCGATATGAGGCTGAGGCGACCACCAGCCGGAGGAGAACAGGCAAAGGGAAGAAAGGTATTGCTGGAGGACCATGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

11.97

Weight (kDa)

8.63

Isoelectric Point (pI)

33.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016274)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g32740
malus_domestica MD15G1066100.v1.1
prunus_persica Prupe.1G419900_v2.0.a1
pyrus_communis pycom08g06540 pycom15g06240
rosa_chinensis RchiOBHm_Chr6g0309931
rosa_laevigata RLG00000010523
rosa_multiflora Rmu_co8261055.1_g000001
rosa_roxburghii Rroxscaffold_7G00159030
rosa_rugosa Rorug06G0376000
rosa_samantha Rh6AG489900 Rh6BG499300 Rh6CG504200 Rh6DG490400
rosa_wichuraiana Rw6G042640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 39
AfiI CCNNNNNNNGG 4 cut(s) 72, 177, 288, 291
AgsI TTSAA 1 cut(s) 34
AleI CACNNNNGTG 1 cut(s) 105
Alw21I GWGCWC 1 cut(s) 185
AoxI GGCC 2 cut(s) 3, 74
AspS9I GGNCC 2 cut(s) 75, 329
AsuC2I CCSGG 1 cut(s) 73
AvaII GGWCC 1 cut(s) 329
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 1 cut(s) 185
BbvCI CCTCAGC 1 cut(s) 273
BccI CCATC 1 cut(s) 113
BceAI ACGGC 2 cut(s) 106, 229
BcgI CGANNNNNNTGC 2 cut(s) 178, 212
BcnI CCSGG 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 73
Bme18I GGWCC 1 cut(s) 329
BmgT120I GGNCC 2 cut(s) 75, 329
BmrFI CCNGG 1 cut(s) 73
BmsI GCATC 2 cut(s) 176, 198
BplI GAGNNNNNCTC 2 cut(s) 167, 199
Bpu10I CCTNAGC 1 cut(s) 273
BpuMI CCSGG 1 cut(s) 73
BsaWI WCCGGW 1 cut(s) 39
Bsc4I CCNNNNNNNGG 4 cut(s) 72, 177, 288, 291
BseGI GGATG 2 cut(s) 167, 189
BseLI CCNNNNNNNGG 4 cut(s) 72, 177, 288, 291
BseMII CTCAG 1 cut(s) 264
BseRI GAGGAG 3 cut(s) 7, 10, 307
BshFI GGCC 2 cut(s) 5, 76
BsiHKAI GWGCWC 1 cut(s) 185
BsiSI CCGG 3 cut(s) 40, 73, 289
BslFI GGGAC 1 cut(s) 55
BslI CCNNNNNNNGG 4 cut(s) 72, 177, 288, 291
BsmFI GGGAC 1 cut(s) 55
BsnI GGCC 2 cut(s) 5, 76
Bsp1286I GDGCHC 1 cut(s) 185
BspANI GGCC 2 cut(s) 5, 76
BspCNI CTCAG 1 cut(s) 265
Bst4CI ACNGT 2 cut(s) 104, 146
BstDEI CTNAG 2 cut(s) 172, 273
BstENI CCTNNNNNAGG 1 cut(s) 175
BstF5I GGATG 2 cut(s) 167, 189
BstMWI GCNNNNNNNGC 1 cut(s) 222
BstSCI CCNGG 1 cut(s) 71
BsuRI GGCC 2 cut(s) 5, 76
BtgZI GCGATG 2 cut(s) 81, 231
BtsCI GGATG 2 cut(s) 167, 189
BtsIMutI CAGTG 1 cut(s) 151
Cfr13I GGNCC 2 cut(s) 75, 329
CviAII CATG 1 cut(s) 333
CviJI RGCY 7 cut(s) 5, 76, 93, 128, 136, 272, 288
CviKI_1 RGCY 7 cut(s) 5, 76, 93, 128, 136, 272, 288
DdeI CTNAG 2 cut(s) 172, 273
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 329
Eco57I CTGAAG 1 cut(s) 39
EcoNI CCTNNNNNAGG 1 cut(s) 175
FaeI CATG 1 cut(s) 336
FaiI YATR 3 cut(s) 131, 267, 334
FaqI GGGAC 1 cut(s) 55
FatI CATG 1 cut(s) 332
FokI GGATG 2 cut(s) 154, 176
HaeIII GGCC 2 cut(s) 5, 76
HapII CCGG 3 cut(s) 40, 73, 289
Hin1II CATG 1 cut(s) 336
HincII GTYRAC 1 cut(s) 45
HindII GTYRAC 1 cut(s) 45
HinfI GANTC 1 cut(s) 256
HpaII CCGG 3 cut(s) 40, 73, 289
Hpy166II GTNNAC 2 cut(s) 45, 61
Hpy8I GTNNAC 2 cut(s) 45, 61
Hpy99I CGWCG 1 cut(s) 254
HpyCH4III ACNGT 2 cut(s) 104, 146
HpyCH4V TGCA 3 cut(s) 167, 189, 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 222
HpyF3I CTNAG 2 cut(s) 172, 273
Hsp92II CATG 1 cut(s) 336
LpnPI CCDG 6 cut(s) 53, 86, 285, 298, 302, 309
LweI GCATC 2 cut(s) 176, 198
MaeIII GTNAC 1 cut(s) 148
MboII GAAGA 3 cut(s) 22, 251, 322
MhlI GDGCHC 1 cut(s) 185
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 8 cut(s) 25, 28, 31, 171, 262, 268, 285, 320
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 141, 246
MslI CAYNNNNRTG 1 cut(s) 105
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 3 cut(s) 40, 73, 289
MspR9I CCNGG 1 cut(s) 73
MwoI GCNNNNNNNGC 1 cut(s) 222
NciI CCSGG 1 cut(s) 73
NlaIII CATG 1 cut(s) 336
NmuCI GTSAC 1 cut(s) 148
OliI CACNNNNGTG 1 cut(s) 105
PfeI GAWTC 1 cut(s) 256
PspPI GGNCC 2 cut(s) 75, 329
RseI CAYNNNNRTG 1 cut(s) 105
SaqAI TTAA 2 cut(s) 141, 246
Sau96I GGNCC 2 cut(s) 75, 329
ScrFI CCNGG 1 cut(s) 73
SduI GDGCHC 1 cut(s) 185
SetI ASST 4 cut(s) 17, 117, 182, 319
SfaNI GCATC 2 cut(s) 176, 198
SinI GGWCC 1 cut(s) 329
SmiMI CAYNNNNRTG 1 cut(s) 105
StyD4I CCNGG 1 cut(s) 71
TaaI ACNGT 2 cut(s) 104, 146
TaqI TCGA 2 cut(s) 83, 262
TfiI GAWTC 1 cut(s) 256
Tru1I TTAA 2 cut(s) 141, 246
Tru9I TTAA 2 cut(s) 141, 246
TscAI CASTG 1 cut(s) 151
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
TspGWI ACGGA 1 cut(s) 182
TspRI CASTG 1 cut(s) 151
VpaK11BI GGWCC 1 cut(s) 329
XagI CCTNNNNNAGG 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.