MD15G1071900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0019273
Physical Location & Seq
Reverse (-)
4932682 .. 4933432
751 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1071900.v1.1.491

Sequence Viewer

Length: 177 bp
ATGCATCTGACTTTTGTTATCCAGTGGGCTGGAGTGGTTTTAGGACAAGGATTGTCTGCCCACCCTTTTTTCATGCCCTTCCATGCCTTCCTATTTGTGTGGTCACAGTTAAGTCACGTCAACATTTTATATTACTATTCATTTTTGTCTTATTATCTTTATAAAAAAATAATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.93

Weight (kDa)

9.16

Isoelectric Point (pI)

50.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 162
AjiI CACGTC 1 cut(s) 118
BmgBI CACGTC 1 cut(s) 118
BmsI GCATC 1 cut(s) 13
BpmI CTGGAG 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 22
BseNI ACTGG 1 cut(s) 22
BsrI ACTGG 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 108
BstXI CCANNNNNNTGG 1 cut(s) 29
BtrI CACGTC 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 29
CviAII CATG 2 cut(s) 73, 83
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 76, 86
FaiI YATR 5 cut(s) 74, 84, 130, 162, 175
FatI CATG 2 cut(s) 72, 82
GsuI CTGGAG 1 cut(s) 51
Hin1II CATG 2 cut(s) 76, 86
HincII GTYRAC 1 cut(s) 121
HindII GTYRAC 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 121
Hpy188I TCNGA 1 cut(s) 9
Hpy8I GTNNAC 1 cut(s) 121
HpyAV CCTTC 2 cut(s) 88, 97
HpyCH4III ACNGT 1 cut(s) 108
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 1 cut(s) 117
Hsp92II CATG 2 cut(s) 76, 86
LpnPI CCDG 2 cut(s) 15, 35
LweI GCATC 1 cut(s) 13
MaeII ACGT 1 cut(s) 117
MaeIII GTNAC 2 cut(s) 102, 113
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 110
NlaIII CATG 2 cut(s) 76, 86
NmuCI GTSAC 2 cut(s) 102, 113
NsiI ATGCAT 1 cut(s) 6
PsiI TTATAA 1 cut(s) 162
SaqAI TTAA 1 cut(s) 110
SetI ASST 1 cut(s) 120
SfaNI GCATC 1 cut(s) 13
SgeI CNNG 6 cut(s) 34, 42, 59, 85, 95, 128
TaaI ACNGT 1 cut(s) 108
TaiI ACGT 1 cut(s) 120
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TscAI CASTG 1 cut(s) 29
TseFI GTSAC 2 cut(s) 102, 113
Tsp45I GTSAC 2 cut(s) 102, 113
TspDTI ATGAA 2 cut(s) 61, 129
TspRI CASTG 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.