MD17G1150100.v1.1

Acyl carrier protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0013707
Physical Location & Seq
Forward (+)
13785155 .. 13787298
2144 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1150100.v1.1.491

Sequence Viewer

Length: 366 bp
ATGCAGGGAGGGCCAGTGGTTAAAGGGCTAAGACTTGTACCAAAGATCAAAATCACTAAGGCAGCAGGAAGATCATTTGCACTCCCTAGTTGCACTAAGACTACAATCTCATGCTCCATTGCTCAACCAGAGACCCTGCTAACTGTGCAAAGCACAATTGCGAAGCAACTCTCCATTGATGAAAGCACTGTGCTTCCCGAAACCAAGTTTGTCGATTTGGGGGCGGATTCTCTCGACACAGTTGAAATCCTAATGGCTTTGGAGGAGAAGTTCGGCGTGTCCGTCGGAGAAGGAGGAGCTGAGAACATTGCAACCGTTCAAGACGCTGCTGATCTGATTGAGAAAGTGAAATCCGCTTCAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP-binding

Protein Analysis

122

Amino Acids

12.62

Weight (kDa)

4.92

Isoelectric Point (pI)

50.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP-binding PF00550 49 - 113 7.1e-11 Phosphopantetheine attachment site
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 224, 354
AfaI GTAC 1 cut(s) 39
AgsI TTSAA 3 cut(s) 245, 320, 360
AloI GAACNNNNNNTCC 2 cut(s) 254, 286
AluBI AGCT 1 cut(s) 299
AluI AGCT 1 cut(s) 299
Alw26I GTCTC 1 cut(s) 125
AoxI GGCC 1 cut(s) 11
ApeKI GCWGC 2 cut(s) 62, 326
AspS9I GGNCC 1 cut(s) 11
BbvI GCAGC 2 cut(s) 74, 313
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 1 cut(s) 87
BisI GCNGC 2 cut(s) 63, 327
BlsI GCNGC 2 cut(s) 64, 328
BmgT120I GGNCC 1 cut(s) 11
BsaBI GATNNNNATC 1 cut(s) 50
BsaI GGTCTC 1 cut(s) 125
BsaXI ACNNNNNCTCC 3 cut(s) 30, 254, 284
Bse1I ACTGG 1 cut(s) 14
Bse3DI GCAATG 2 cut(s) 117, 306
Bse8I GATNNNNATC 1 cut(s) 50
BseJI GATNNNNATC 1 cut(s) 50
BseMI GCAATG 2 cut(s) 117, 306
BseMII CTCAG 1 cut(s) 291
BseNI ACTGG 1 cut(s) 14
BseRI GAGGAG 2 cut(s) 278, 309
BseXI GCAGC 2 cut(s) 74, 313
BshFI GGCC 1 cut(s) 13
BsmAI GTCTC 1 cut(s) 125
BsnI GGCC 1 cut(s) 13
Bso31I GGTCTC 1 cut(s) 125
Bsp143I GATC 3 cut(s) 45, 71, 331
BspACI CCGC 2 cut(s) 224, 354
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 1 cut(s) 292
BspTNI GGTCTC 1 cut(s) 125
BsrDI GCAATG 2 cut(s) 117, 306
BsrI ACTGG 1 cut(s) 14
BssMI GATC 3 cut(s) 45, 71, 331
Bst4CI ACNGT 4 cut(s) 145, 190, 241, 316
BstDEI CTNAG 4 cut(s) 29, 57, 96, 300
BstKTI GATC 3 cut(s) 48, 74, 334
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 3 cut(s) 45, 71, 331
BstMWI GCNNNNNNNGC 2 cut(s) 10, 145
BstV1I GCAGC 2 cut(s) 74, 313
BsuRI GGCC 1 cut(s) 13
BtsIMutI CAGTG 2 cut(s) 21, 186
Cfr13I GGNCC 1 cut(s) 11
CseI GACGC 1 cut(s) 332
Csp6I GTAC 1 cut(s) 38
CviAII CATG 1 cut(s) 111
CviJI RGCY 4 cut(s) 13, 28, 257, 299
CviKI_1 RGCY 4 cut(s) 13, 28, 257, 299
CviQI GTAC 1 cut(s) 38
DdeI CTNAG 4 cut(s) 29, 57, 96, 300
DpnI GATC 3 cut(s) 47, 73, 333
DpnII GATC 3 cut(s) 45, 71, 331
EciI GGCGGA 1 cut(s) 239
Eco31I GGTCTC 1 cut(s) 125
FaeI CATG 1 cut(s) 114
FaiI YATR 1 cut(s) 112
FatI CATG 1 cut(s) 110
Fnu4HI GCNGC 2 cut(s) 63, 327
Fsp4HI GCNGC 2 cut(s) 63, 327
FspBI CTAG 1 cut(s) 87
GluI GCNGC 2 cut(s) 63, 327
HaeIII GGCC 1 cut(s) 13
HgaI GACGC 1 cut(s) 332
Hin1II CATG 1 cut(s) 114
HinfI GANTC 1 cut(s) 227
Hpy188I TCNGA 2 cut(s) 287, 336
Hpy188III TCNNGA 3 cut(s) 197, 233, 320
Hpy99I CGWCG 1 cut(s) 287
HpyAV CCTTC 1 cut(s) 284
HpyCH4III ACNGT 4 cut(s) 145, 190, 241, 316
HpyCH4V TGCA 5 cut(s) 4, 80, 93, 148, 311
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 145
HpyF3I CTNAG 4 cut(s) 29, 57, 96, 300
Hsp92II CATG 1 cut(s) 114
Kzo9I GATC 3 cut(s) 45, 71, 331
LmnI GCTCC 2 cut(s) 119, 296
LpnPI CCDG 4 cut(s) 27, 51, 141, 149
Lsp1109I GCAGC 2 cut(s) 74, 313
MaeI CTAG 1 cut(s) 87
MalI GATC 3 cut(s) 47, 73, 333
MboI GATC 3 cut(s) 45, 71, 331
MboII GAAGA 1 cut(s) 81
MfeI CAATTG 1 cut(s) 156
MluCI AATT 1 cut(s) 156
MmeI TCCRAC 1 cut(s) 265
MnlI CCTC 2 cut(s) 256, 287
MseI TTAA 2 cut(s) 21, 364
MunI CAATTG 1 cut(s) 156
MwoI GCNNNNNNNGC 2 cut(s) 10, 145
NdeII GATC 3 cut(s) 45, 71, 331
NlaIII CATG 1 cut(s) 114
PcsI WCGNNNNNNNCGW 1 cut(s) 279
PfeI GAWTC 1 cut(s) 227
PkrI GCNGC 2 cut(s) 64, 328
PspPI GGNCC 1 cut(s) 11
RsaI GTAC 1 cut(s) 39
RsaNI GTAC 1 cut(s) 38
SaqAI TTAA 2 cut(s) 21, 364
SatI GCNGC 2 cut(s) 63, 327
Sau3AI GATC 3 cut(s) 45, 71, 331
Sau96I GGNCC 1 cut(s) 11
SetI ASST 1 cut(s) 301
Sse9I AATT 1 cut(s) 156
SsiI CCGC 2 cut(s) 224, 354
SspMI CTAG 1 cut(s) 87
TaaI ACNGT 4 cut(s) 145, 190, 241, 316
TaqI TCGA 2 cut(s) 213, 234
TasI AATT 1 cut(s) 156
TfiI GAWTC 1 cut(s) 227
Tru1I TTAA 2 cut(s) 21, 364
Tru9I TTAA 2 cut(s) 21, 364
TscAI CASTG 2 cut(s) 21, 193
TseI GCWGC 2 cut(s) 62, 326
TspDTI ATGAA 1 cut(s) 195
TspGWI ACGGA 1 cut(s) 271
TspRI CASTG 2 cut(s) 21, 193
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.