RLG00000020220

Acyl carrier protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
OG0013707
Physical Location & Seq
Forward (+)
62595859 .. 62597357
1499 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000020220

Sequence Viewer

Length: 456 bp
ATGGCTTCTTTTGTTTCAAATTCCCCAATCCCTGTGGCCACTCTGCCTTACACTGCTAAGGCCAGAAGCACAGTTTGCCAAATTAATGGCTTCTCTAGCATTGAAGGTCCAGTGGTTAGAGGGCTAAGAATTATGCCAAAGATCAAGATCACCAAGGCAGCAGAAAGATCATTTCCAGTCCCTAGTTGCTTGAAGACCACAATCTCATGTTCCATCGCTCAACCGGAAACTCTCCAAACTGTTCAAAGCACTATTGCCAAGCAACTATCCGTTGATGAAAGCACCGTCACTCCTCAGACCAAGTTCGCCGATTTGGGGGCAGATTCTCTAGACACTGTTGAAATTATGATGGCTTTGGAGGAGAAGTTTGGTGTGTCCATCGGAGAAGGGGGAGCTGAGAATATCGCTACCGTTCAAGATGCTGCTGATCTGATTGAGAAAGTGAAATCAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP-binding

Protein Analysis

152

Amino Acids

15.93

Weight (kDa)

5.18

Isoelectric Point (pI)

55.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP-binding PF00550 79 - 145 2.8e-12 Phosphopantetheine attachment site
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 36
AcsI RAATTY 1 cut(s) 19
AfiI CCNNNNNNNGG 1 cut(s) 315
AgsI TTSAA 6 cut(s) 18, 104, 193, 245, 341, 416
AluBI AGCT 1 cut(s) 395
AluI AGCT 1 cut(s) 395
AoxI GGCC 2 cut(s) 36, 60
ApeKI GCWGC 2 cut(s) 158, 422
ApoI RAATTY 1 cut(s) 19
AseI ATTAAT 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 142
AvaII GGWCC 1 cut(s) 107
BalI TGGCCA 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 200
BbvI GCAGC 2 cut(s) 170, 409
BccI CCATC 3 cut(s) 221, 343, 386
BfaI CTAG 3 cut(s) 96, 183, 329
BisI GCNGC 2 cut(s) 159, 423
BlsI GCNGC 2 cut(s) 160, 424
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmsI GCATC 1 cut(s) 409
BpiI GAAGAC 1 cut(s) 200
Bpu10I CCTNAGC 1 cut(s) 57
BsaBI GATNNNNATC 1 cut(s) 146
BsaJI CCNNGG 1 cut(s) 153
BsaWI WCCGGW 1 cut(s) 223
BsaXI ACNNNNNCTCC 4 cut(s) 274, 304, 350, 380
Bsc4I CCNNNNNNNGG 1 cut(s) 315
Bse1I ACTGG 2 cut(s) 110, 176
Bse8I GATNNNNATC 1 cut(s) 146
BseDI CCNNGG 1 cut(s) 153
BseJI GATNNNNATC 1 cut(s) 146
BseLI CCNNNNNNNGG 1 cut(s) 315
BseMII CTCAG 2 cut(s) 308, 387
BseNI ACTGG 2 cut(s) 110, 176
BseRI GAGGAG 2 cut(s) 282, 374
BseXI GCAGC 2 cut(s) 170, 409
BshFI GGCC 2 cut(s) 38, 62
BsiSI CCGG 1 cut(s) 224
BslFI GGGAC 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 315
BsmFI GGGAC 1 cut(s) 164
BsnI GGCC 2 cut(s) 38, 62
Bsp143I GATC 4 cut(s) 141, 147, 167, 427
BspANI GGCC 2 cut(s) 38, 62
BspCNI CTCAG 2 cut(s) 307, 388
BsrI ACTGG 2 cut(s) 110, 176
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 4 cut(s) 141, 147, 167, 427
BssT1I CCWWGG 1 cut(s) 153
Bst4CI ACNGT 5 cut(s) 73, 241, 286, 337, 412
BstAPI GCANNNNNTGC 1 cut(s) 75
BstDEI CTNAG 4 cut(s) 57, 125, 294, 396
BstKTI GATC 4 cut(s) 144, 150, 170, 430
BstMBI GATC 4 cut(s) 141, 147, 167, 427
BstMWI GCNNNNNNNGC 2 cut(s) 75, 96
BstV1I GCAGC 2 cut(s) 170, 409
BstV2I GAAGAC 1 cut(s) 200
BstXI CCANNNNNNTGG 1 cut(s) 86
BsuRI GGCC 2 cut(s) 38, 62
BtgZI GCGATG 1 cut(s) 199
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 3 cut(s) 51, 117, 333
Cfr13I GGNCC 1 cut(s) 107
CspCI CAANNNNNGTGG 2 cut(s) 15, 50
CviAII CATG 2 cut(s) 207, 453
CviJI RGCY 7 cut(s) 5, 38, 62, 90, 124, 353, 395
CviKI_1 RGCY 7 cut(s) 5, 38, 62, 90, 124, 353, 395
DdeI CTNAG 4 cut(s) 57, 125, 294, 396
DpnI GATC 4 cut(s) 143, 149, 169, 429
DpnII GATC 4 cut(s) 141, 147, 167, 427
EaeI YGGCCR 1 cut(s) 36
Eco130I CCWWGG 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 107
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 2 cut(s) 210, 456
FaiI YATR 4 cut(s) 134, 208, 347, 454
FaqI GGGAC 1 cut(s) 164
FatI CATG 2 cut(s) 206, 452
Fnu4HI GCNGC 2 cut(s) 159, 423
Fsp4HI GCNGC 2 cut(s) 159, 423
FspBI CTAG 3 cut(s) 96, 183, 329
GluI GCNGC 2 cut(s) 159, 423
HaeIII GGCC 2 cut(s) 38, 62
HapII CCGG 1 cut(s) 224
Hin1II CATG 2 cut(s) 210, 456
HinfI GANTC 1 cut(s) 323
HpaII CCGG 1 cut(s) 224
HphI GGTGA 1 cut(s) 142
Hpy188I TCNGA 3 cut(s) 297, 383, 432
Hpy188III TCNNGA 3 cut(s) 145, 329, 416
HpyAV CCTTC 2 cut(s) 98, 380
HpyCH4III ACNGT 5 cut(s) 73, 241, 286, 337, 412
HpyF10VI GCNNNNNNNGC 2 cut(s) 75, 96
HpyF3I CTNAG 4 cut(s) 57, 125, 294, 396
Hsp92II CATG 2 cut(s) 210, 456
Kzo9I GATC 4 cut(s) 141, 147, 167, 427
LmnI GCTCC 1 cut(s) 392
LpnPI CCDG 5 cut(s) 45, 76, 123, 189, 237
Lsp1109I GCAGC 2 cut(s) 170, 409
LweI GCATC 1 cut(s) 409
MaeI CTAG 3 cut(s) 96, 183, 329
MaeIII GTNAC 1 cut(s) 286
MalI GATC 4 cut(s) 143, 149, 169, 429
MboI GATC 4 cut(s) 141, 147, 167, 427
MboII GAAGA 1 cut(s) 205
MlsI TGGCCA 1 cut(s) 38
MluCI AATT 4 cut(s) 19, 81, 129, 342
MluNI TGGCCA 1 cut(s) 38
MnlI CCTC 3 cut(s) 113, 303, 352
Mox20I TGGCCA 1 cut(s) 38
MscI TGGCCA 1 cut(s) 38
MseI TTAA 1 cut(s) 84
Msp20I TGGCCA 1 cut(s) 38
MspI CCGG 1 cut(s) 224
MwoI GCNNNNNNNGC 2 cut(s) 75, 96
NdeII GATC 4 cut(s) 141, 147, 167, 427
NlaIII CATG 2 cut(s) 210, 456
NmuCI GTSAC 1 cut(s) 286
PfeI GAWTC 1 cut(s) 323
PkrI GCNGC 2 cut(s) 160, 424
PshBI ATTAAT 1 cut(s) 84
PspPI GGNCC 1 cut(s) 107
SaqAI TTAA 1 cut(s) 84
SatI GCNGC 2 cut(s) 159, 423
Sau3AI GATC 4 cut(s) 141, 147, 167, 427
Sau96I GGNCC 1 cut(s) 107
SetI ASST 2 cut(s) 109, 397
SfaNI GCATC 1 cut(s) 409
SinI GGWCC 1 cut(s) 107
Sse9I AATT 4 cut(s) 19, 81, 129, 342
SspMI CTAG 3 cut(s) 96, 183, 329
StyI CCWWGG 1 cut(s) 153
TaaI ACNGT 5 cut(s) 73, 241, 286, 337, 412
TasI AATT 4 cut(s) 19, 81, 129, 342
TfiI GAWTC 1 cut(s) 323
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TscAI CASTG 3 cut(s) 58, 117, 340
TseFI GTSAC 1 cut(s) 286
TseI GCWGC 2 cut(s) 158, 422
Tsp45I GTSAC 1 cut(s) 286
TspDTI ATGAA 1 cut(s) 291
TspGWI ACGGA 1 cut(s) 259
TspRI CASTG 3 cut(s) 58, 117, 340
VpaK11BI GGWCC 1 cut(s) 107
VspI ATTAAT 1 cut(s) 84
XapI RAATTY 1 cut(s) 19
XbaI TCTAGA 1 cut(s) 328
XspI CTAG 3 cut(s) 96, 183, 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.