MD17G1155700.v1.1

Lipase (class 3)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
14832694 .. 14833163
470 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1155700.v1.1.491

Sequence Viewer

Length: 150 bp
ATGTCAGTGCTGGTGTTGCATGAGGAGATGAAGGTGATGCAAAGGTTGTTGGGTGTGTACACATTTGGACAGCCTAGGGTAGGGGACAGGAAGCTGGCAAGGTACATGGACGATCGGTTCCAAAGTACTCAGGGTTGTCTACTGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.75

Weight (kDa)

9.1

Isoelectric Point (pI)

42.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lipase_3 PF01764 6 - 42 2.5e-06 Lipase (class 3)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017699)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 139
AfaI GTAC 3 cut(s) 59, 104, 127
AfiI CCNNNNNNNGG 1 cut(s) 80
AloI GAACNNNNNNTCC 2 cut(s) 101, 133
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
AspA2I CCTAGG 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 46
AvrII CCTAGG 1 cut(s) 74
BfaI CTAG 1 cut(s) 75
BlnI CCTAGG 1 cut(s) 74
BmcAI AGTACT 1 cut(s) 127
BmiI GGNNCC 1 cut(s) 119
BmsI GCATC 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 74
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 80
BseMII CTCAG 1 cut(s) 143
BseRI GAGGAG 1 cut(s) 38
Bsh1285I CGRYCG 1 cut(s) 115
BsiEI CGRYCG 1 cut(s) 115
BslFI GGGAC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 80
BsmFI GGGAC 1 cut(s) 98
Bsp1407I TGTACA 1 cut(s) 57
Bsp143I GATC 1 cut(s) 112
BspCNI CTCAG 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 119
BsrGI TGTACA 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 74
BssMI GATC 1 cut(s) 112
BssT1I CCWWGG 1 cut(s) 74
BstAUI TGTACA 1 cut(s) 57
BstC8I GCNNGC 1 cut(s) 96
BstDEI CTNAG 1 cut(s) 129
BstENI CCTNNNNNAGG 1 cut(s) 78
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMCI CGRYCG 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 16
BtsIMutI CAGTG 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 96
Csp6I GTAC 3 cut(s) 58, 103, 126
CviAII CATG 2 cut(s) 20, 106
CviJI RGCY 2 cut(s) 73, 94
CviKI_1 RGCY 2 cut(s) 73, 94
CviQI GTAC 3 cut(s) 58, 103, 126
DdeI CTNAG 1 cut(s) 129
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco130I CCWWGG 1 cut(s) 74
EcoNI CCTNNNNNAGG 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 74
ErhI CCWWGG 1 cut(s) 74
FaeI CATG 2 cut(s) 23, 109
FaiI YATR 2 cut(s) 21, 107
FaqI GGGAC 1 cut(s) 98
FatI CATG 2 cut(s) 19, 105
FblI GTMKAC 1 cut(s) 139
FspBI CTAG 1 cut(s) 75
Hin1II CATG 2 cut(s) 23, 109
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 3 cut(s) 58, 60, 140
Hpy8I GTNNAC 3 cut(s) 58, 60, 140
HpyAV CCTTC 1 cut(s) 25
HpyCH4V TGCA 3 cut(s) 19, 40, 145
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 2 cut(s) 23, 109
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 3 cut(s) 73, 80, 116
LweI GCATC 1 cut(s) 27
MaeI CTAG 1 cut(s) 75
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MnlI CCTC 1 cut(s) 16
MwoI GCNNNNNNNGC 1 cut(s) 16
NdeII GATC 1 cut(s) 112
NlaIII CATG 2 cut(s) 23, 109
NlaIV GGNNCC 1 cut(s) 119
Ple19I CGATCG 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 119
PvuI CGATCG 1 cut(s) 115
RsaI GTAC 3 cut(s) 59, 104, 127
RsaNI GTAC 3 cut(s) 58, 103, 126
Sau3AI GATC 1 cut(s) 112
ScaI AGTACT 1 cut(s) 127
SetI ASST 4 cut(s) 36, 47, 96, 104
SfaNI GCATC 1 cut(s) 27
SgeI CNNG 8 cut(s) 23, 32, 87, 100, 107, 111, 118, 143
SspMI CTAG 1 cut(s) 75
StyI CCWWGG 1 cut(s) 74
TatI WGTACW 2 cut(s) 57, 125
TscAI CASTG 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 44
TspRI CASTG 1 cut(s) 12
XagI CCTNNNNNAGG 1 cut(s) 78
XmaJI CCTAGG 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 139
XspI CTAG 1 cut(s) 75
ZrmI AGTACT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.