Rmu_co8278977.1_g000001

Lipase (class 3)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8278977.1
Physical Location & Seq
Reverse (-)
1 .. 833
833 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8278977.1_g000001.1.cds

Sequence Viewer

Length: 378 bp
atggtagagaagagtgcatactatgctgtaagaaaaaagctcaagagcttactagaggagcacaaaaacgcaaaattcgttgttacagggcatagtctaggtggggcacttgcgatattgttcccttgtgtgctggtgttgcatgaggagatggagttgatggataggttgttgggtatatatacatttggacagccaaggatagggaataggcagctggggaggtacatggaagtccatctgaataagccggtccaaaagtacttcagggttgtctactccaacgatcttgtccccaggttgccttatgatgacagaaccttcttgtttaaacatttcggtgtctgcctttactacgacagcctatacaatgaacat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.8

Weight (kDa)

9.06

Isoelectric Point (pI)

32.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017699)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 276
AcsI RAATTY 1 cut(s) 74
AcuI CTGAAG 1 cut(s) 250
AfaI GTAC 2 cut(s) 227, 263
AfiI CCNNNNNNNGG 1 cut(s) 203
AjnI CCWGG 1 cut(s) 296
AluBI AGCT 3 cut(s) 40, 48, 217
AluI AGCT 3 cut(s) 40, 48, 217
Alw21I GWGCWC 1 cut(s) 63
ApeKI GCWGC 1 cut(s) 214
ApoI RAATTY 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 253
AvaII GGWCC 1 cut(s) 253
BaeGI GKGCMC 1 cut(s) 109
BarI GAAGNNNNNNTAC 1 cut(s) 34
Bbv12I GWGCWC 1 cut(s) 63
BbvI GCAGC 1 cut(s) 226
BccI CCATC 3 cut(s) 145, 154, 246
BciT130I CCWGG 1 cut(s) 298
BfaI CTAG 2 cut(s) 53, 98
BisI GCNGC 1 cut(s) 215
BlsI GCNGC 1 cut(s) 216
BmcAI AGTACT 1 cut(s) 263
Bme1390I CCNGG 1 cut(s) 298
Bme18I GGWCC 1 cut(s) 253
BmgT120I GGNCC 1 cut(s) 253
BmrFI CCNGG 1 cut(s) 298
BpuEI CTTGAG 1 cut(s) 26
BsaJI CCNNGG 2 cut(s) 197, 296
BsaXI ACNNNNNCTCC 2 cut(s) 140, 170
Bsc4I CCNNNNNNNGG 1 cut(s) 203
Bse118I RCCGGY 1 cut(s) 250
BseBI CCWGG 1 cut(s) 298
BseDI CCNNGG 2 cut(s) 197, 296
BseLI CCNNNNNNNGG 1 cut(s) 203
BseRI GAGGAG 2 cut(s) 71, 161
BseSI GKGCMC 1 cut(s) 109
BseXI GCAGC 1 cut(s) 226
BseYI CCCAGC 1 cut(s) 217
BsiHKAI GWGCWC 1 cut(s) 63
BsiSI CCGG 1 cut(s) 251
BslFI GGGAC 1 cut(s) 278
BslI CCNNNNNNNGG 1 cut(s) 203
BsmFI GGGAC 1 cut(s) 278
Bsp1286I GDGCHC 2 cut(s) 63, 109
Bsp143I GATC 1 cut(s) 286
BsrFI RCCGGY 1 cut(s) 250
BssAI RCCGGY 1 cut(s) 250
BssECI CCNNGG 2 cut(s) 197, 296
BssMI GATC 1 cut(s) 286
BssT1I CCWWGG 1 cut(s) 197
Bst2UI CCWGG 1 cut(s) 298
Bst6I CTCTTC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 23
BstKTI GATC 1 cut(s) 289
BstMBI GATC 1 cut(s) 286
BstMWI GCNNNNNNNGC 2 cut(s) 23, 139
BstNI CCWGG 1 cut(s) 298
BstSCI CCNGG 1 cut(s) 296
BstSLI GKGCMC 1 cut(s) 109
BstV1I GCAGC 1 cut(s) 226
Cfr10I RCCGGY 1 cut(s) 250
Cfr13I GGNCC 1 cut(s) 253
Csp6I GTAC 2 cut(s) 226, 262
CviAII CATG 2 cut(s) 143, 229
CviJI RGCY 6 cut(s) 40, 48, 196, 217, 250, 363
CviKI_1 RGCY 6 cut(s) 40, 48, 196, 217, 250, 363
CviQI GTAC 2 cut(s) 226, 262
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
DraI TTTAAA 1 cut(s) 331
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
Eco130I CCWWGG 1 cut(s) 197
Eco47I GGWCC 1 cut(s) 253
Eco57I CTGAAG 1 cut(s) 250
EcoRII CCWGG 1 cut(s) 296
EcoT14I CCWWGG 1 cut(s) 197
ErhI CCWWGG 1 cut(s) 197
FaeI CATG 2 cut(s) 146, 232
FaqI GGGAC 1 cut(s) 278
FatI CATG 2 cut(s) 142, 228
FblI GTMKAC 1 cut(s) 276
Fnu4HI GCNGC 1 cut(s) 215
Fsp4HI GCNGC 1 cut(s) 215
FspBI CTAG 2 cut(s) 53, 98
GluI GCNGC 1 cut(s) 215
GsaI CCCAGC 1 cut(s) 221
HapII CCGG 1 cut(s) 251
Hin1II CATG 2 cut(s) 146, 232
HpaII CCGG 1 cut(s) 251
Hpy166II GTNNAC 1 cut(s) 277
Hpy188I TCNGA 1 cut(s) 243
Hpy188III TCNNGA 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 277
HpyAV CCTTC 1 cut(s) 331
HpyCH4V TGCA 2 cut(s) 17, 142
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 139
Hsp92II CATG 2 cut(s) 146, 232
Kzo9I GATC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 7 cut(s) 72, 119, 203, 253, 264, 283, 310
Lsp1109I GCAGC 1 cut(s) 226
MaeI CTAG 2 cut(s) 53, 98
MaeIII GTNAC 1 cut(s) 82
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 1 cut(s) 22
MhlI GDGCHC 2 cut(s) 63, 109
MluCI AATT 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 3 cut(s) 49, 139, 216
MseI TTAA 1 cut(s) 330
MslI CAYNNNNRTG 1 cut(s) 339
MspA1I CMGCKG 1 cut(s) 217
MspI CCGG 1 cut(s) 251
MspR9I CCNGG 1 cut(s) 298
MssI GTTTAAAC 1 cut(s) 331
MvaI CCWGG 1 cut(s) 298
MwoI GCNNNNNNNGC 2 cut(s) 23, 139
NdeII GATC 1 cut(s) 286
NlaIII CATG 2 cut(s) 146, 232
PcsI WCGNNNNNNNCGW 1 cut(s) 75
PkrI GCNGC 1 cut(s) 216
PmeI GTTTAAAC 1 cut(s) 331
Psp6I CCWGG 1 cut(s) 296
PspFI CCCAGC 1 cut(s) 217
PspGI CCWGG 1 cut(s) 296
PspPI GGNCC 1 cut(s) 253
PvuII CAGCTG 1 cut(s) 217
RsaI GTAC 2 cut(s) 227, 263
RsaNI GTAC 2 cut(s) 226, 262
RseI CAYNNNNRTG 1 cut(s) 339
SaqAI TTAA 1 cut(s) 330
SatI GCNGC 1 cut(s) 215
Sau3AI GATC 1 cut(s) 286
Sau96I GGNCC 1 cut(s) 253
ScaI AGTACT 1 cut(s) 263
ScrFI CCNGG 1 cut(s) 298
SduI GDGCHC 2 cut(s) 63, 109
SetI ASST 8 cut(s) 42, 50, 103, 170, 219, 227, 302, 323
SinI GGWCC 1 cut(s) 253
SmiMI CAYNNNNRTG 1 cut(s) 339
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 1 cut(s) 74
SspMI CTAG 2 cut(s) 53, 98
StyD4I CCNGG 1 cut(s) 296
StyI CCWWGG 1 cut(s) 197
TasI AATT 1 cut(s) 74
TatI WGTACW 1 cut(s) 261
Tru1I TTAA 1 cut(s) 330
Tru9I TTAA 1 cut(s) 330
TseI GCWGC 1 cut(s) 214
VpaK11BI GGWCC 1 cut(s) 253
XapI RAATTY 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 276
XspI CTAG 2 cut(s) 53, 98
ZrmI AGTACT 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.