MD17G1216400.v1.1

Phosphopantothenoylcysteine decarboxylase subunit VHS3-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
26327310 .. 26328070
761 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1216400.v1.1.491

Sequence Viewer

Length: 417 bp
ATGATTGGAGTTGGATCTTTGCGTGATGATCGTGATGCATTTCAAGATTCAGTGAGAACAGATCAGAGGTTTCCAATGTCCGAACTTAATAAAGGGAAAGAGCCTGATGCTGAAAACAACGATGCAGGTGAACCAGAGGATGACGACTCTGATGATGATGAAGATGTCGACGATGAGGACAGTGACGATAATGATGAGGATGACGGTAATGATTCAGAAGAAGATAGTGATGATGACGAAGAAGATTCTGATGATGAGGTTGAGGCTAATGGCAATGGAGAAAACGATGATGAAGATGATGACGAAGATGATGATGGTGATGATGATGATGAAGACGATGATGATGAGGAGGATGAGGATGACGAGGATGACGAGGAGCTTAACAAGTTGCCTTCAGAAAGAAAGAAAGTAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

139

Amino Acids

15.58

Weight (kDa)

4.05

Isoelectric Point (pI)

55.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017336)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g29250
malus_domestica MD17G1216400.v1.1
prunus_persica Prupe.3G092600_v2.0.a1
pyrus_communis pycom17g22100
rosa_chinensis RchiOBHm_Chr2g0134421
rosa_multiflora Rmu_sc0005464.1_g000007 Rmu_sc0005571.1_g000034
rosa_rugosa Rorug02G0317000
rosa_samantha Rh2AG369600 Rh2BG375500 Rh2CG353200 Rh2DG392600
rosa_wichuraiana Rw2G030100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 116
Acc36I ACCTGC 1 cut(s) 116
AccI GTMKAC 1 cut(s) 168
AclWI GGATC 1 cut(s) 22
AcuI CTGAAG 1 cut(s) 378
AgsI TTSAA 1 cut(s) 44
AluBI AGCT 1 cut(s) 379
AluI AGCT 1 cut(s) 379
AlwI GGATC 1 cut(s) 22
AsuHPI GGTGA 2 cut(s) 140, 329
BbsI GAAGAC 1 cut(s) 339
BccI CCATC 1 cut(s) 308
BfuAI ACCTGC 1 cut(s) 116
BmsI GCATC 3 cut(s) 25, 97, 112
BpiI GAAGAC 1 cut(s) 339
Bse3DI GCAATG 1 cut(s) 280
BseGI GGATG 5 cut(s) 145, 205, 358, 364, 373
BseMI GCAATG 1 cut(s) 280
BseRI GAGGAG 2 cut(s) 362, 389
Bsp143I GATC 3 cut(s) 14, 28, 61
BspMI ACCTGC 1 cut(s) 116
BspPI GGATC 1 cut(s) 22
BsrDI GCAATG 1 cut(s) 280
BssMI GATC 3 cut(s) 14, 28, 61
Bst4CI ACNGT 2 cut(s) 182, 206
BstF5I GGATG 5 cut(s) 145, 205, 358, 364, 373
BstKTI GATC 3 cut(s) 17, 31, 64
BstMBI GATC 3 cut(s) 14, 28, 61
BstV2I GAAGAC 1 cut(s) 339
BstX2I RGATCY 1 cut(s) 14
BstYI RGATCY 1 cut(s) 14
BtsCI GGATG 5 cut(s) 145, 205, 358, 364, 373
BtsIMutI CAGTG 2 cut(s) 57, 187
BveI ACCTGC 1 cut(s) 116
CviJI RGCY 3 cut(s) 103, 266, 379
CviKI_1 RGCY 3 cut(s) 103, 266, 379
DpnI GATC 3 cut(s) 16, 30, 63
DpnII GATC 3 cut(s) 14, 28, 61
Eco57I CTGAAG 1 cut(s) 378
EcoT22I ATGCAT 1 cut(s) 40
FblI GTMKAC 1 cut(s) 168
FokI GGATG 5 cut(s) 152, 212, 365, 371, 380
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HinfI GANTC 4 cut(s) 47, 146, 212, 245
HphI GGTGA 2 cut(s) 140, 329
Hpy166II GTNNAC 2 cut(s) 131, 169
Hpy188I TCNGA 6 cut(s) 66, 82, 151, 217, 250, 397
Hpy188III TCNNGA 2 cut(s) 32, 44
Hpy8I GTNNAC 2 cut(s) 131, 169
Hpy99I CGWCG 1 cut(s) 173
HpyAV CCTTC 1 cut(s) 402
HpyCH4III ACNGT 2 cut(s) 182, 206
HpyCH4V TGCA 2 cut(s) 38, 125
Kzo9I GATC 3 cut(s) 14, 28, 61
LmnI GCTCC 1 cut(s) 376
LpnPI CCDG 3 cut(s) 111, 117, 147
LweI GCATC 3 cut(s) 25, 97, 112
MaeIII GTNAC 1 cut(s) 182
MalI GATC 3 cut(s) 16, 30, 63
MboI GATC 3 cut(s) 14, 28, 61
MboII GAAGA 8 cut(s) 173, 230, 233, 251, 254, 305, 317, 344
MflI RGATCY 1 cut(s) 14
MlyI GAGTC 1 cut(s) 140
Mph1103I ATGCAT 1 cut(s) 40
MseI TTAA 2 cut(s) 87, 381
NdeII GATC 3 cut(s) 14, 28, 61
NmuCI GTSAC 1 cut(s) 182
NsiI ATGCAT 1 cut(s) 40
PaqCI CACCTGC 1 cut(s) 116
PcsI WCGNNNNNNNCGW 1 cut(s) 369
PfeI GAWTC 3 cut(s) 47, 212, 245
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
PsuI RGATCY 1 cut(s) 14
SalI GTCGAC 1 cut(s) 167
SaqAI TTAA 2 cut(s) 87, 381
Sau3AI GATC 3 cut(s) 14, 28, 61
SchI GAGTC 1 cut(s) 140
SetI ASST 4 cut(s) 71, 130, 261, 381
SfaNI GCATC 3 cut(s) 25, 97, 112
SgeI CNNG 9 cut(s) 35, 44, 56, 116, 138, 146, 376, 385, 397
TaaI ACNGT 2 cut(s) 182, 206
TaqI TCGA 1 cut(s) 168
TfiI GAWTC 3 cut(s) 47, 212, 245
Tru1I TTAA 2 cut(s) 87, 381
Tru9I TTAA 2 cut(s) 87, 381
TscAI CASTG 2 cut(s) 57, 187
TseFI GTSAC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 3 cut(s) 174, 306, 345
TspRI CASTG 2 cut(s) 57, 187
XmiI GTMKAC 1 cut(s) 168
Zsp2I ATGCAT 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.