Rh2AG369600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
54913780 .. 54915197
1418 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG369600.1

Sequence Viewer

Length: 185 bp
ATGGATATCCACACTCTTTCTAATGGTGCTGCTGATCTCGACAGCCTTAAGTGCTCTCTGGTGGAATCTTTGTTGGCTGAGACAGCGATTCTTGCTCACAAGTCTTTTCTTTTACTACTCTTGCTGGTTTGGTCTTCACCTAACCAAAAAAATGTGCTTCTGAATTCAGTGAGAACAGATCAGAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.66

Weight (kDa)

5.37

Isoelectric Point (pI)

25.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017336)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g29250
malus_domestica MD17G1216400.v1.1
prunus_persica Prupe.3G092600_v2.0.a1
pyrus_communis pycom17g22100
rosa_chinensis RchiOBHm_Chr2g0134421
rosa_multiflora Rmu_sc0005464.1_g000007 Rmu_sc0005571.1_g000034
rosa_rugosa Rorug02G0317000
rosa_samantha Rh2AG369600 Rh2BG375500 Rh2CG353200 Rh2DG392600
rosa_wichuraiana Rw2G030100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 163
AflII CTTAAG 1 cut(s) 47
Alw21I GWGCWC 1 cut(s) 56
Alw26I GTCTC 1 cut(s) 74
ApeKI GCWGC 1 cut(s) 29
ApoI RAATTY 1 cut(s) 163
AsuHPI GGTGA 1 cut(s) 129
BbsI GAAGAC 1 cut(s) 126
Bbv12I GWGCWC 1 cut(s) 56
BbvI GCAGC 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 74
BfrI CTTAAG 1 cut(s) 47
BisI GCNGC 1 cut(s) 30
BlsI GCNGC 1 cut(s) 31
BpiI GAAGAC 1 cut(s) 126
BseMII CTCAG 1 cut(s) 69
BseXI GCAGC 1 cut(s) 16
BsiHKAI GWGCWC 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 56
Bsp143I GATC 2 cut(s) 34, 178
BspCNI CTCAG 1 cut(s) 70
BspTI CTTAAG 1 cut(s) 47
BssMI GATC 2 cut(s) 34, 178
BstAFI CTTAAG 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 2 cut(s) 37, 181
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 2 cut(s) 34, 178
BstMWI GCNNNNNNNGC 3 cut(s) 51, 83, 92
BstV1I GCAGC 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 126
BtsIMutI CAGTG 1 cut(s) 174
CviJI RGCY 2 cut(s) 45, 77
CviKI_1 RGCY 2 cut(s) 45, 77
DdeI CTNAG 1 cut(s) 78
DpnI GATC 2 cut(s) 36, 180
DpnII GATC 2 cut(s) 34, 178
Eco32I GATATC 1 cut(s) 7
EcoRI GAATTC 1 cut(s) 163
EcoRV GATATC 1 cut(s) 7
Fnu4HI GCNGC 1 cut(s) 30
Fsp4HI GCNGC 1 cut(s) 30
GluI GCNGC 1 cut(s) 30
HinfI GANTC 2 cut(s) 65, 88
HphI GGTGA 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 162, 183
Hpy188III TCNNGA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 3 cut(s) 51, 83, 92
HpyF3I CTNAG 1 cut(s) 78
Kzo9I GATC 2 cut(s) 34, 178
LpnPI CCDG 2 cut(s) 44, 110
Lsp1109I GCAGC 1 cut(s) 16
MalI GATC 2 cut(s) 36, 180
MboI GATC 2 cut(s) 34, 178
MboII GAAGA 1 cut(s) 126
MhlI GDGCHC 1 cut(s) 56
MluCI AATT 1 cut(s) 163
MseI TTAA 1 cut(s) 48
MspCI CTTAAG 1 cut(s) 47
MwoI GCNNNNNNNGC 3 cut(s) 51, 83, 92
NdeII GATC 2 cut(s) 34, 178
PfeI GAWTC 2 cut(s) 65, 88
PkrI GCNGC 1 cut(s) 31
SaqAI TTAA 1 cut(s) 48
SatI GCNGC 1 cut(s) 30
Sau3AI GATC 2 cut(s) 34, 178
SduI GDGCHC 1 cut(s) 56
SetI ASST 1 cut(s) 142
SgeI CNNG 6 cut(s) 50, 71, 104, 112, 133, 137
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
Sse9I AATT 1 cut(s) 163
TaqI TCGA 1 cut(s) 39
TasI AATT 1 cut(s) 163
TfiI GAWTC 2 cut(s) 65, 88
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 1 cut(s) 174
TseI GCWGC 1 cut(s) 29
TspRI CASTG 1 cut(s) 174
Vha464I CTTAAG 1 cut(s) 47
XapI RAATTY 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.