Prupe.3G092600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
6914725 .. 6916763
2039 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G092600.1

Sequence Viewer

Length: 516 bp
ATGGAGATCCAGAGTTTCTGCCACAGTGCTGATGATTTGAAGGGCATTATGCGCTGTTTGGTTGAATCTTTGATGGTGGAGACTGCTCTTCTTGCTCACAAGTCTCTTCTTTTACTACTTCTGCAGATTGGGTCTTTGCCTGACGATCATGACATATTTCAAAACTCAGTGAAAACATATCAGAGGTTTCCAATGTCCGAACTTAATAAAGTGAAAGAGCCTGATGCTGAAAACAACGATGCAGGTGAAACAAAGGATGATGATGACGATGATGATGATGATGAGGACAGTGATGATGATGATGAAGATGATGGTGATGATTCAGAAGAAGAGAGCGATGATGATGAAGAGGATTTGGATGACGAGGTTGAGGTTGAGGCTAATGGCGATGGAGAAAGCGATGACGATGACGATGACGATGGTGAAGAAGATGACGATGATGAGGATGATGATGATGAAGAGGATGATGATGATGAAGAGGATCATTACCAGCTACCGTTGACAAGAAAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

172

Amino Acids

19.42

Weight (kDa)

4.05

Isoelectric Point (pI)

50.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017336)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g29250
malus_domestica MD17G1216400.v1.1
prunus_persica Prupe.3G092600_v2.0.a1
pyrus_communis pycom17g22100
rosa_chinensis RchiOBHm_Chr2g0134421
rosa_multiflora Rmu_sc0005464.1_g000007 Rmu_sc0005571.1_g000034
rosa_rugosa Rorug02G0317000
rosa_samantha Rh2AG369600 Rh2BG375500 Rh2CG353200 Rh2DG392600
rosa_wichuraiana Rw2G030100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 233
Acc36I ACCTGC 1 cut(s) 233
AclWI GGATC 1 cut(s) 489
AgsI TTSAA 3 cut(s) 40, 65, 161
AluBI AGCT 1 cut(s) 493
AluI AGCT 1 cut(s) 493
Alw26I GTCTC 2 cut(s) 74, 108
AlwI GGATC 1 cut(s) 489
AspLEI GCGC 1 cut(s) 54
AsuHPI GGTGA 3 cut(s) 257, 326, 434
BccI CCATC 4 cut(s) 67, 305, 383, 413
BcoDI GTCTC 2 cut(s) 74, 108
BfmI CTRYAG 1 cut(s) 122
BfuAI ACCTGC 1 cut(s) 233
BmsI GCATC 2 cut(s) 214, 229
BseGI GGATG 4 cut(s) 262, 364, 451, 469
BseMII CTCAG 1 cut(s) 180
BsmAI GTCTC 2 cut(s) 74, 108
Bsp143I GATC 3 cut(s) 6, 145, 481
BspCNI CTCAG 1 cut(s) 179
BspHI TCATGA 1 cut(s) 148
BspMAI CTGCAG 1 cut(s) 126
BspMI ACCTGC 1 cut(s) 233
BspPI GGATC 1 cut(s) 489
BspQI GCTCTTC 1 cut(s) 93
BssMI GATC 3 cut(s) 6, 145, 481
Bst4CI ACNGT 3 cut(s) 26, 290, 498
Bst6I CTCTTC 6 cut(s) 93, 111, 324, 342, 453, 471
BstDEI CTNAG 1 cut(s) 166
BstF5I GGATG 4 cut(s) 262, 364, 451, 469
BstHHI GCGC 1 cut(s) 54
BstKTI GATC 3 cut(s) 9, 148, 484
BstMAI GTCTC 2 cut(s) 74, 108
BstMBI GATC 3 cut(s) 6, 145, 481
BstMWI GCNNNNNNNGC 2 cut(s) 51, 92
BstSFI CTRYAG 1 cut(s) 122
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
BtgZI GCGATG 3 cut(s) 351, 402, 414
BtsCI GGATG 4 cut(s) 262, 364, 451, 469
BtsIMutI CAGTG 3 cut(s) 31, 174, 295
BveI ACCTGC 1 cut(s) 233
CciI TCATGA 1 cut(s) 148
CfoI GCGC 1 cut(s) 54
CviAII CATG 1 cut(s) 149
CviJI RGCY 3 cut(s) 220, 380, 493
CviKI_1 RGCY 3 cut(s) 220, 380, 493
DdeI CTNAG 1 cut(s) 166
DpnI GATC 3 cut(s) 8, 147, 483
DpnII GATC 3 cut(s) 6, 145, 481
Eam1104I CTCTTC 6 cut(s) 93, 111, 324, 342, 453, 471
EarI CTCTTC 6 cut(s) 93, 111, 324, 342, 453, 471
FaeI CATG 1 cut(s) 152
FaiI YATR 4 cut(s) 50, 150, 155, 178
FatI CATG 1 cut(s) 148
FokI GGATG 4 cut(s) 269, 371, 458, 476
GlaI GCGC 1 cut(s) 53
HhaI GCGC 1 cut(s) 54
Hin1II CATG 1 cut(s) 152
Hin6I GCGC 1 cut(s) 52
HinP1I GCGC 1 cut(s) 52
HincII GTYRAC 1 cut(s) 501
HindII GTYRAC 1 cut(s) 501
HinfI GANTC 2 cut(s) 65, 320
HphI GGTGA 3 cut(s) 257, 326, 434
Hpy166II GTNNAC 1 cut(s) 501
Hpy188I TCNGA 3 cut(s) 183, 199, 325
Hpy188III TCNNGA 2 cut(s) 10, 149
Hpy8I GTNNAC 1 cut(s) 501
HpyAV CCTTC 1 cut(s) 34
HpyCH4III ACNGT 3 cut(s) 26, 290, 498
HpyCH4V TGCA 2 cut(s) 124, 242
HpyF10VI GCNNNNNNNGC 2 cut(s) 51, 92
HpyF3I CTNAG 1 cut(s) 166
Hsp92II CATG 1 cut(s) 152
HspAI GCGC 1 cut(s) 52
Kzo9I GATC 3 cut(s) 6, 145, 481
LguI GCTCTTC 1 cut(s) 93
LpnPI CCDG 5 cut(s) 23, 153, 228, 234, 503
LweI GCATC 2 cut(s) 214, 229
MalI GATC 3 cut(s) 8, 147, 483
MboI GATC 3 cut(s) 6, 145, 481
MflI RGATCY 1 cut(s) 6
MnlI CCTC 9 cut(s) 177, 277, 343, 358, 364, 370, 436, 454, 472
MseI TTAA 1 cut(s) 204
MwoI GCNNNNNNNGC 2 cut(s) 51, 92
NdeII GATC 3 cut(s) 6, 145, 481
NlaIII CATG 1 cut(s) 152
PagI TCATGA 1 cut(s) 148
PaqCI CACCTGC 1 cut(s) 233
PciSI GCTCTTC 1 cut(s) 93
PfeI GAWTC 2 cut(s) 65, 320
PstI CTGCAG 1 cut(s) 126
PsuI RGATCY 1 cut(s) 6
SapI GCTCTTC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 3 cut(s) 6, 145, 481
SetI ASST 5 cut(s) 188, 247, 369, 375, 495
SfaNI GCATC 2 cut(s) 214, 229
SfcI CTRYAG 1 cut(s) 122
SgeI CNNG 9 cut(s) 22, 104, 112, 152, 161, 233, 255, 376, 502
TaaI ACNGT 3 cut(s) 26, 290, 498
TfiI GAWTC 2 cut(s) 65, 320
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 3 cut(s) 31, 174, 295
TspDTI ATGAA 4 cut(s) 318, 360, 471, 489
TspRI CASTG 3 cut(s) 31, 174, 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.