Prupe.1G284200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
28586737 .. 28592032
5296 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G284200.1

Sequence Viewer

Length: 360 bp
ATGTACTTACCCAGGAGGTGGAGATTTGTGATGATAGCTGGTGTCGCTTCCGCCTATTGGTGTGAAAAAACTCATAATATTCGAGATTTGAAAGCTTTAATGGACAAGGCTGAGATTAACGAATGCGAAATTGTGGAAAAGATAGCCGAGGAAATGTGCTGTTTTGGCATGCTCGTTGGGAAGATCAAGGACCGATTCGGTCATATTTGGGAACTCAGCAGCTCGGCTGGTAAGAAATCCGATAAGAAATTCGACAAGTCCTCTCTTGTGAACTTTATTTTTTATTTTTTGAGATATTTTGTATCTGTTTCAGTTTTGCTTTTGCTTAATCCACTTTCTTTATTAATTCTTACTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

13.83

Weight (kDa)

8.93

Isoelectric Point (pI)

41.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 358
AccB7I CCANNNNNTGG 1 cut(s) 18
AciI CCGC 1 cut(s) 51
AcsI RAATTY 1 cut(s) 248
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 2 cut(s) 18, 57
AgsI TTSAA 1 cut(s) 91
AjnI CCWGG 1 cut(s) 11
AluBI AGCT 3 cut(s) 38, 95, 222
AluI AGCT 3 cut(s) 38, 95, 222
ApeKI GCWGC 1 cut(s) 219
ApoI RAATTY 1 cut(s) 248
AseI ATTAAT 1 cut(s) 344
AspS9I GGNCC 1 cut(s) 190
AvaII GGWCC 1 cut(s) 190
BbvI GCAGC 1 cut(s) 231
BciT130I CCWGG 1 cut(s) 13
BisI GCNGC 1 cut(s) 220
BlsI GCNGC 1 cut(s) 221
Bme1390I CCNGG 1 cut(s) 13
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 190
BmrFI CCNGG 1 cut(s) 13
BsaJI CCNNGG 2 cut(s) 11, 147
Bsc4I CCNNNNNNNGG 2 cut(s) 18, 57
BseBI CCWGG 1 cut(s) 13
BseDI CCNNGG 2 cut(s) 11, 147
BseLI CCNNNNNNNGG 2 cut(s) 18, 57
BseMII CTCAG 2 cut(s) 102, 229
BseXI GCAGC 1 cut(s) 231
BslI CCNNNNNNNGG 2 cut(s) 18, 57
BsmI GAATGC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 183
BspACI CCGC 1 cut(s) 51
BspCNI CTCAG 2 cut(s) 103, 228
BssECI CCNNGG 2 cut(s) 11, 147
BssMI GATC 1 cut(s) 183
Bst2UI CCWGG 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 170
BstDEI CTNAG 2 cut(s) 111, 215
BstKTI GATC 1 cut(s) 186
BstMBI GATC 1 cut(s) 183
BstMWI GCNNNNNNNGC 2 cut(s) 44, 165
BstNI CCWGG 1 cut(s) 13
BstNSI RCATGY 1 cut(s) 172
BstSCI CCNGG 1 cut(s) 11
BstV1I GCAGC 1 cut(s) 231
Cac8I GCNNGC 1 cut(s) 170
Cfr13I GGNCC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 4
CviAII CATG 1 cut(s) 169
CviJI RGCY 6 cut(s) 38, 95, 110, 146, 222, 227
CviKI_1 RGCY 6 cut(s) 38, 95, 110, 146, 222, 227
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 2 cut(s) 111, 215
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
EciI GGCGGA 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 190
EcoRII CCWGG 1 cut(s) 11
FaeI CATG 1 cut(s) 172
FaiI YATR 4 cut(s) 75, 170, 204, 358
FatI CATG 1 cut(s) 168
Fnu4HI GCNGC 1 cut(s) 220
Fsp4HI GCNGC 1 cut(s) 220
GluI GCNGC 1 cut(s) 220
Hin1II CATG 1 cut(s) 172
HindIII AAGCTT 1 cut(s) 93
HinfI GANTC 1 cut(s) 195
Hpy166II GTNNAC 1 cut(s) 271
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 1 cut(s) 83
Hpy8I GTNNAC 1 cut(s) 271
HpyF10VI GCNNNNNNNGC 2 cut(s) 44, 165
HpyF3I CTNAG 2 cut(s) 111, 215
Hsp92II CATG 1 cut(s) 172
Kzo9I GATC 1 cut(s) 183
LpnPI CCDG 3 cut(s) 24, 25, 213
Lsp1109I GCAGC 1 cut(s) 231
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 1 cut(s) 193
MluCI AATT 3 cut(s) 129, 248, 345
MnlI CCTC 3 cut(s) 9, 142, 271
MseI TTAA 4 cut(s) 98, 117, 327, 344
MspR9I CCNGG 1 cut(s) 13
Mva1269I GAATGC 1 cut(s) 128
MvaI CCWGG 1 cut(s) 13
MwoI GCNNNNNNNGC 2 cut(s) 44, 165
NdeII GATC 1 cut(s) 183
NlaIII CATG 1 cut(s) 172
NmeAIII GCCGAG 2 cut(s) 172, 203
NspI RCATGY 1 cut(s) 172
PaeI GCATGC 1 cut(s) 172
PctI GAATGC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 195
PflMI CCANNNNNTGG 1 cut(s) 18
PkrI GCNGC 1 cut(s) 221
PshBI ATTAAT 1 cut(s) 344
PsiI TTATAA 1 cut(s) 358
Psp6I CCWGG 1 cut(s) 11
PspGI CCWGG 1 cut(s) 11
PspPI GGNCC 1 cut(s) 190
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 4 cut(s) 98, 117, 327, 344
SatI GCNGC 1 cut(s) 220
Sau3AI GATC 1 cut(s) 183
Sau96I GGNCC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 13
SetI ASST 4 cut(s) 20, 40, 97, 224
SinI GGWCC 1 cut(s) 190
SphI GCATGC 1 cut(s) 172
Sse9I AATT 3 cut(s) 129, 248, 345
SsiI CCGC 1 cut(s) 51
SspI AATATT 1 cut(s) 79
StyD4I CCNGG 1 cut(s) 11
TaqI TCGA 2 cut(s) 82, 252
TaqII GACCGA 2 cut(s) 188, 207
TasI AATT 3 cut(s) 129, 248, 345
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 1 cut(s) 195
Tru1I TTAA 4 cut(s) 98, 117, 327, 344
Tru9I TTAA 4 cut(s) 98, 117, 327, 344
TseI GCWGC 1 cut(s) 219
Van91I CCANNNNNTGG 1 cut(s) 18
VpaK11BI GGWCC 1 cut(s) 190
VspI ATTAAT 1 cut(s) 344
XapI RAATTY 1 cut(s) 248
XceI RCATGY 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.