Prupe.1G571800_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0018520
Physical Location & Seq
Reverse (-)
46611916 .. 46613864
1949 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G571800.1

Sequence Viewer

Length: 177 bp
ATGCCTCAGAGCTGGTCTGCAACTTCTGTGTTCATCCATGGCTGGTGTATACGTCTCTGGCACAGGCAGGGGAGGGTGCCGAAAGCCTGCGTTGTATCCATTGTCGCTGGAAGCTTCGAGTGTACCAATTTCGCAACTTGGCAATTTGGATTTCTATCTCGATTTCTCAGTAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.66

Weight (kDa)

10.13

Isoelectric Point (pI)

57.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 76
AccI GTMKAC 1 cut(s) 49
AfaI GTAC 1 cut(s) 124
AluBI AGCT 2 cut(s) 12, 114
AluI AGCT 2 cut(s) 12, 114
Alw26I GTCTC 1 cut(s) 59
BanI GGYRCC 1 cut(s) 76
BciVI GTATCC 1 cut(s) 106
BcoDI GTCTC 1 cut(s) 59
BfuI GTATCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 78
BsaBI GATNNNNATC 1 cut(s) 154
BsaJI CCNNGG 1 cut(s) 37
Bse8I GATNNNNATC 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 37
BseGI GGATG 1 cut(s) 33
BseJI GATNNNNATC 1 cut(s) 154
BseMII CTCAG 1 cut(s) 20
BshNI GGYRCC 1 cut(s) 76
BsmAI GTCTC 1 cut(s) 59
BsmBI CGTCTC 1 cut(s) 59
Bsp19I CCATGG 1 cut(s) 37
BspCNI CTCAG 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 78
BspT107I GGYRCC 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 37
BssNAI GTATAC 1 cut(s) 50
BssT1I CCWWGG 1 cut(s) 37
Bst1107I GTATAC 1 cut(s) 50
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 2 cut(s) 6, 167
BstDSI CCRYGG 1 cut(s) 37
BstF5I GGATG 1 cut(s) 33
BstMAI GTCTC 1 cut(s) 59
BstZ17I GTATAC 1 cut(s) 50
BsuI GTATCC 1 cut(s) 106
BtgI CCRYGG 1 cut(s) 37
BtsCI GGATG 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 88
Csp6I GTAC 1 cut(s) 123
CviAII CATG 1 cut(s) 38
CviJI RGCY 4 cut(s) 12, 42, 86, 114
CviKI_1 RGCY 4 cut(s) 12, 42, 86, 114
CviQI GTAC 1 cut(s) 123
DdeI CTNAG 2 cut(s) 6, 167
Eco130I CCWWGG 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 37
ErhI CCWWGG 1 cut(s) 37
Esp3I CGTCTC 1 cut(s) 59
FaeI CATG 1 cut(s) 41
FaiI YATR 2 cut(s) 39, 50
FatI CATG 1 cut(s) 37
FblI GTMKAC 1 cut(s) 49
FokI GGATG 1 cut(s) 20
Hin1II CATG 1 cut(s) 41
HindIII AAGCTT 1 cut(s) 112
Hpy166II GTNNAC 2 cut(s) 50, 123
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 1 cut(s) 159
Hpy8I GTNNAC 2 cut(s) 50, 123
HpyCH4IV ACGT 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 20
HpyF3I CTNAG 2 cut(s) 6, 167
HpySE526I ACGT 1 cut(s) 52
Hsp92II CATG 1 cut(s) 41
LpnPI CCDG 6 cut(s) 28, 43, 49, 53, 93, 100
MaeII ACGT 1 cut(s) 52
MluCI AATT 2 cut(s) 127, 143
MnlI CCTC 2 cut(s) 15, 66
NcoI CCATGG 1 cut(s) 37
NlaIII CATG 1 cut(s) 41
NlaIV GGNNCC 1 cut(s) 78
PspN4I GGNNCC 1 cut(s) 78
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
SetI ASST 3 cut(s) 14, 55, 116
Sse9I AATT 2 cut(s) 127, 143
StyI CCWWGG 1 cut(s) 37
TaiI ACGT 1 cut(s) 55
TaqI TCGA 2 cut(s) 117, 160
TasI AATT 2 cut(s) 127, 143
TspDTI ATGAA 1 cut(s) 22
XmiI GTMKAC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.