Prupe.2G109300_v2.0.a1

Late embryogenesis abundant (LEA) group 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0017358
Physical Location & Seq
Forward (+)
16773686 .. 16774513
828 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G109300.1

Sequence Viewer

Length: 324 bp
ATGCAGGCTGTGAAGGACAAGATAAATGAAATGGGCGCACTGCGCAAGGTCAAGGCCGAGGCCAGGGCCGAAGAGAGGGCTGAGAAAGAAGTAGCCAAGGCGAGATCCGATGTAGCACATGAGGTGAGATTGGCTAAAGAGGCCGAGGCATCAATGTCAATGCATGTGGCGAAAGCTGGGGACATTGCTAGAGCTGGAGAAAAGTTTGCGCATGATCATCAAATGGTAGCTCATGCGCCTGAAAATACTACTAACACAGCTCATCAGGCTCGTTCTTCTGACAAGACATCGGGAGGTCCCCCAACTTACAACCCAATGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_1

Protein Analysis

108

Amino Acids

11.58

Weight (kDa)

8.07

Isoelectric Point (pI)

31.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017358)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g08030
malus_domestica MD00G1098100.v1.1 MD02G1236800.v1.1
prunus_persica Prupe.2G109300_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0341271
rosa_laevigata RLG00000029078
rosa_roxburghii Rroxscaffold_4G00311910
rosa_rugosa Rorug01G0158200.1
rosa_samantha Rh1AG172600 Rh1BG140700 Rh1CG160700 Rh1DG172900
rosa_wichuraiana Rw1G014400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 2 cut(s) 44, 210
AclWI GGATC 1 cut(s) 99
AfiI CCNNNNNNNGG 2 cut(s) 63, 75
AjnI CCWGG 1 cut(s) 62
AluBI AGCT 4 cut(s) 176, 194, 230, 260
AluI AGCT 4 cut(s) 176, 194, 230, 260
AlwI GGATC 1 cut(s) 99
AoxI GGCC 4 cut(s) 54, 60, 66, 141
AspLEI GCGC 4 cut(s) 38, 45, 211, 238
AspS9I GGNCC 2 cut(s) 66, 296
AsuHPI GGTGA 1 cut(s) 136
AvaII GGWCC 1 cut(s) 296
BciT130I CCWGG 1 cut(s) 64
BclI TGATCA 1 cut(s) 214
BfaI CTAG 1 cut(s) 189
Bme1390I CCNGG 1 cut(s) 64
Bme18I GGWCC 1 cut(s) 296
BmgT120I GGNCC 2 cut(s) 66, 296
BmiI GGNNCC 1 cut(s) 298
BmrFI CCNGG 1 cut(s) 64
BmsI GCATC 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 216
BsaJI CCNNGG 4 cut(s) 57, 63, 96, 144
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 75
Bse3DI GCAATG 1 cut(s) 183
BseBI CCWGG 1 cut(s) 64
BseDI CCNNGG 4 cut(s) 57, 63, 96, 144
BseLI CCNNNNNNNGG 2 cut(s) 63, 75
BseMI GCAATG 1 cut(s) 183
BseMII CTCAG 1 cut(s) 72
BseYI CCCAGC 1 cut(s) 176
BshFI GGCC 4 cut(s) 56, 62, 68, 143
BslFI GGGAC 2 cut(s) 194, 282
BslI CCNNNNNNNGG 2 cut(s) 63, 75
BsmFI GGGAC 2 cut(s) 194, 282
BsnI GGCC 4 cut(s) 56, 62, 68, 143
Bsp143I GATC 2 cut(s) 104, 214
BspANI GGCC 4 cut(s) 56, 62, 68, 143
BspCNI CTCAG 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 298
BspPI GGATC 1 cut(s) 99
BsrDI GCAATG 1 cut(s) 183
BssECI CCNNGG 4 cut(s) 57, 63, 96, 144
BssMI GATC 2 cut(s) 104, 214
BssT1I CCWWGG 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 66
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 81
BstHHI GCGC 4 cut(s) 38, 45, 211, 238
BstKTI GATC 2 cut(s) 107, 217
BstMBI GATC 2 cut(s) 104, 214
BstMWI GCNNNNNNNGC 3 cut(s) 42, 140, 266
BstNI CCWGG 1 cut(s) 64
BstNSI RCATGY 1 cut(s) 167
BstSCI CCNGG 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
BsuRI GGCC 4 cut(s) 56, 62, 68, 143
BtsI GCAGTG 1 cut(s) 38
BtsIMutI CAGTG 1 cut(s) 38
Cac8I GCNNGC 1 cut(s) 6
CfoI GCGC 4 cut(s) 38, 45, 211, 238
Cfr13I GGNCC 2 cut(s) 66, 296
CspCI CAANNNNNGTGG 2 cut(s) 147, 182
CviAII CATG 4 cut(s) 119, 164, 212, 233
DdeI CTNAG 1 cut(s) 81
DpnI GATC 2 cut(s) 106, 216
DpnII GATC 2 cut(s) 104, 214
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
Eco130I CCWWGG 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 296
EcoO109I RGGNCCY 1 cut(s) 296
EcoRII CCWGG 1 cut(s) 62
EcoT14I CCWWGG 1 cut(s) 96
EcoT22I ATGCAT 1 cut(s) 165
ErhI CCWWGG 1 cut(s) 96
FaeI CATG 4 cut(s) 122, 167, 215, 236
FaiI YATR 4 cut(s) 120, 165, 213, 234
FaqI GGGAC 2 cut(s) 194, 282
FatI CATG 4 cut(s) 118, 163, 211, 232
FbaI TGATCA 1 cut(s) 214
FspBI CTAG 1 cut(s) 189
FspI TGCGCA 2 cut(s) 44, 210
GlaI GCGC 4 cut(s) 37, 44, 210, 237
GsaI CCCAGC 1 cut(s) 180
GsuI CTGGAG 1 cut(s) 216
HaeIII GGCC 4 cut(s) 56, 62, 68, 143
HhaI GCGC 4 cut(s) 38, 45, 211, 238
Hin1II CATG 4 cut(s) 122, 167, 215, 236
Hin6I GCGC 4 cut(s) 36, 43, 209, 236
HinP1I GCGC 4 cut(s) 36, 43, 209, 236
HphI GGTGA 1 cut(s) 136
Hpy188I TCNGA 2 cut(s) 109, 280
Hpy188III TCNNGA 1 cut(s) 291
HpyAV CCTTC 1 cut(s) 7
HpyCH4V TGCA 2 cut(s) 4, 163
HpyF10VI GCNNNNNNNGC 3 cut(s) 42, 140, 266
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 4 cut(s) 122, 167, 215, 236
HspAI GCGC 4 cut(s) 36, 43, 209, 236
Ksp22I TGATCA 1 cut(s) 214
Kzo9I GATC 2 cut(s) 104, 214
LpnPI CCDG 6 cut(s) 49, 76, 162, 180, 251, 252
LweI GCATC 1 cut(s) 158
MaeI CTAG 1 cut(s) 189
MalI GATC 2 cut(s) 106, 216
MboI GATC 2 cut(s) 104, 214
MboII GAAGA 2 cut(s) 83, 267
MflI RGATCY 1 cut(s) 104
MnlI CCTC 6 cut(s) 52, 69, 115, 133, 139, 287
Mph1103I ATGCAT 1 cut(s) 165
MseI TTAA 1 cut(s) 322
MspR9I CCNGG 1 cut(s) 64
MvaI CCWGG 1 cut(s) 64
MwoI GCNNNNNNNGC 3 cut(s) 42, 140, 266
NdeII GATC 2 cut(s) 104, 214
NlaIII CATG 4 cut(s) 122, 167, 215, 236
NlaIV GGNNCC 1 cut(s) 298
NmeAIII GCCGAG 2 cut(s) 82, 169
NsbI TGCGCA 2 cut(s) 44, 210
NsiI ATGCAT 1 cut(s) 165
NspI RCATGY 1 cut(s) 167
PpuMI RGGWCCY 1 cut(s) 296
Psp5II RGGWCCY 1 cut(s) 296
Psp6I CCWGG 1 cut(s) 62
PspFI CCCAGC 1 cut(s) 176
PspGI CCWGG 1 cut(s) 62
PspN4I GGNNCC 1 cut(s) 298
PspPI GGNCC 2 cut(s) 66, 296
PspPPI RGGWCCY 1 cut(s) 296
PsuI RGATCY 1 cut(s) 104
SaqAI TTAA 1 cut(s) 322
Sau3AI GATC 2 cut(s) 104, 214
Sau96I GGNCC 2 cut(s) 66, 296
ScrFI CCNGG 1 cut(s) 64
SetI ASST 7 cut(s) 51, 126, 178, 196, 232, 262, 298
SfaNI GCATC 1 cut(s) 158
SinI GGWCC 1 cut(s) 296
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 62
StyI CCWWGG 1 cut(s) 96
Tru1I TTAA 1 cut(s) 322
Tru9I TTAA 1 cut(s) 322
TscAI CASTG 1 cut(s) 45
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 296
XceI RCATGY 1 cut(s) 167
XspI CTAG 1 cut(s) 189
Zsp2I ATGCAT 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.