Prupe.2G187100_v2.0.a1

Nonspecific lipid-transfer protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
22792437 .. 22792778
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G187100.1

Sequence Viewer

Length: 342 bp
ATGACTCGCCTCATCGGATTCCTAGCCGTCCTCTTGTTCCTTTCAAGTTCTGCAAATTCGGCGCCTTCATGCCCTACCGTAACCCAGCAAGTGGCCCCGTGTCTCAGTTTTGTGAAAGGTGGAAGTGACACCAAGCCATCCGAAGAGTGTTGCAAAGGGGTTAAGGAGCTGAGTGTCAATGCTAATTCCAGGCCAGACAGGGAAGCTGTGTGCAAGTGCCTTAAGCAAGTGTTGTCTTCCGTTGGAAACTATAATCCCTCTCAAGTCTCTCTTCTTCCCAAGAAATGTGGCCTGTCCCTCAATCTCCCTCCAATTGATAAAAACACTGACTGCTCAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

11.96

Weight (kDa)

8.84

Isoelectric Point (pI)

41.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016391)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 61
AccB7I CCANNNNNTGG 1 cut(s) 91
AcsI RAATTY 1 cut(s) 55
AcyI GRCGYC 1 cut(s) 62
AfiI CCNNNNNNNGG 1 cut(s) 91
AflII CTTAAG 1 cut(s) 221
AgsI TTSAA 1 cut(s) 45
AjnI CCWGG 1 cut(s) 188
AluBI AGCT 2 cut(s) 169, 206
AluI AGCT 2 cut(s) 169, 206
Alw26I GTCTC 2 cut(s) 107, 271
AoxI GGCC 3 cut(s) 93, 191, 289
ApoI RAATTY 1 cut(s) 55
AspLEI GCGC 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 94
BanI GGYRCC 1 cut(s) 61
BbsI GAAGAC 1 cut(s) 228
BccI CCATC 1 cut(s) 145
BceAI ACGGC 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 190
BcoDI GTCTC 2 cut(s) 107, 271
BfaI CTAG 1 cut(s) 23
BfoI RGCGCY 1 cut(s) 65
BfrI CTTAAG 1 cut(s) 221
Bme1390I CCNGG 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 2 cut(s) 63, 96
BmrFI CCNGG 1 cut(s) 190
BpiI GAAGAC 1 cut(s) 228
BpuEI CTTGAG 1 cut(s) 246
BsaHI GRCGYC 1 cut(s) 62
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 190
BseGI GGATG 1 cut(s) 137
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 2 cut(s) 118, 161
BseYI CCCAGC 1 cut(s) 84
BshFI GGCC 3 cut(s) 95, 193, 291
BshNI GGYRCC 1 cut(s) 61
BslFI GGGAC 1 cut(s) 280
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 2 cut(s) 107, 271
BsmFI GGGAC 1 cut(s) 280
BsnI GGCC 3 cut(s) 95, 193, 291
BspANI GGCC 3 cut(s) 95, 193, 291
BspCNI CTCAG 2 cut(s) 117, 162
BspLI GGNNCC 2 cut(s) 63, 96
BspT107I GGYRCC 1 cut(s) 61
BspTI CTTAAG 1 cut(s) 221
BssNI GRCGYC 1 cut(s) 62
Bst2UI CCWGG 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 79
Bst6I CTCTTC 2 cut(s) 138, 276
BstACI GRCGYC 1 cut(s) 62
BstAFI CTTAAG 1 cut(s) 221
BstDEI CTNAG 2 cut(s) 104, 170
BstF5I GGATG 1 cut(s) 137
BstH2I RGCGCY 1 cut(s) 65
BstHHI GCGC 1 cut(s) 64
BstMAI GTCTC 2 cut(s) 107, 271
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstNI CCWGG 1 cut(s) 190
BstSCI CCNGG 1 cut(s) 188
BstV2I GAAGAC 1 cut(s) 228
BsuRI GGCC 3 cut(s) 95, 193, 291
BtsCI GGATG 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 324
CfoI GCGC 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 94
CspCI CAANNNNNGTGG 2 cut(s) 268, 303
CviAII CATG 1 cut(s) 69
CviJI RGCY 7 cut(s) 26, 95, 136, 169, 193, 206, 291
CviKI_1 RGCY 7 cut(s) 26, 95, 136, 169, 193, 206, 291
DdeI CTNAG 2 cut(s) 104, 170
DinI GGCGCC 1 cut(s) 63
Eam1104I CTCTTC 2 cut(s) 138, 276
EarI CTCTTC 2 cut(s) 138, 276
EcoRII CCWGG 1 cut(s) 188
EgeI GGCGCC 1 cut(s) 63
EheI GGCGCC 1 cut(s) 63
FaeI CATG 1 cut(s) 72
FaiI YATR 2 cut(s) 70, 252
FalI AAGNNNNNCTT 2 cut(s) 255, 287
FaqI GGGAC 1 cut(s) 280
FatI CATG 1 cut(s) 68
FokI GGATG 1 cut(s) 124
FspBI CTAG 1 cut(s) 23
GlaI GCGC 1 cut(s) 63
GsaI CCCAGC 1 cut(s) 88
HaeII RGCGCY 1 cut(s) 65
HaeIII GGCC 3 cut(s) 95, 193, 291
HhaI GCGC 1 cut(s) 64
Hin1I GRCGYC 1 cut(s) 62
Hin1II CATG 1 cut(s) 72
Hin6I GCGC 1 cut(s) 62
HinP1I GCGC 1 cut(s) 62
HinfI GANTC 2 cut(s) 4, 18
Hpy188I TCNGA 2 cut(s) 17, 142
HpyAV CCTTC 1 cut(s) 75
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4V TGCA 3 cut(s) 53, 153, 213
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
HpyF3I CTNAG 2 cut(s) 104, 170
Hsp92I GRCGYC 1 cut(s) 62
Hsp92II CATG 1 cut(s) 72
HspAI GCGC 1 cut(s) 62
KasI GGCGCC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 6 cut(s) 98, 175, 184, 202, 207, 305
MaeI CTAG 1 cut(s) 23
MaeIII GTNAC 2 cut(s) 79, 125
MboII GAAGA 4 cut(s) 155, 228, 263, 266
MfeI CAATTG 1 cut(s) 312
MluCI AATT 3 cut(s) 55, 184, 312
Mly113I GGCGCC 1 cut(s) 62
MmeI TCCRAC 1 cut(s) 223
MnlI CCTC 5 cut(s) 20, 41, 268, 308, 318
MseI TTAA 2 cut(s) 162, 222
MspCI CTTAAG 1 cut(s) 221
MspR9I CCNGG 1 cut(s) 190
MunI CAATTG 1 cut(s) 312
MvaI CCWGG 1 cut(s) 190
MwoI GCNNNNNNNGC 1 cut(s) 59
NarI GGCGCC 1 cut(s) 62
NlaIII CATG 1 cut(s) 72
NlaIV GGNNCC 2 cut(s) 63, 96
NmuCI GTSAC 1 cut(s) 125
PfeI GAWTC 1 cut(s) 18
PflMI CCANNNNNTGG 1 cut(s) 91
PluTI GGCGCC 1 cut(s) 65
Psp6I CCWGG 1 cut(s) 188
PspFI CCCAGC 1 cut(s) 84
PspGI CCWGG 1 cut(s) 188
PspN4I GGNNCC 2 cut(s) 63, 96
PspPI GGNCC 1 cut(s) 94
SaqAI TTAA 2 cut(s) 162, 222
Sau96I GGNCC 1 cut(s) 94
ScrFI CCNGG 1 cut(s) 190
SetI ASST 3 cut(s) 121, 171, 208
SfoI GGCGCC 1 cut(s) 63
SmlI CTYRAG 2 cut(s) 221, 261
SmoI CTYRAG 2 cut(s) 221, 261
Sse9I AATT 3 cut(s) 55, 184, 312
SspDI GGCGCC 1 cut(s) 61
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 188
TaaI ACNGT 1 cut(s) 79
TasI AATT 3 cut(s) 55, 184, 312
TfiI GAWTC 1 cut(s) 18
Tru1I TTAA 2 cut(s) 162, 222
Tru9I TTAA 2 cut(s) 162, 222
TscAI CASTG 1 cut(s) 331
TseFI GTSAC 1 cut(s) 125
Tsp45I GTSAC 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 57
TspGWI ACGGA 1 cut(s) 229
TspRI CASTG 1 cut(s) 331
Van91I CCANNNNNTGG 1 cut(s) 91
Vha464I CTTAAG 1 cut(s) 221
XapI RAATTY 1 cut(s) 55
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.