Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp03

Orthogroup ID

OG0013561

Physical Location & Seq

Genomic Coordinates Reverse (-)

20362793 .. 20364262

Gene Structure 1470 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.3G190900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 408 bp

ATGGCTGCCACGAAAAGGCCTGGAGATGTTGCCAGCGTCGACGTCTACACCGCAAAAGGTCTCCTCAGCGTAGGTCACCGTTATCTGGATGTCAGGACCGTTGAGGAGTTCAACAAGAGCCACGTTGAAAATGCCTTGAACATTCCTTACATGTTCATCACAGAAGAAGGTAGAGTGAAAAACCCTGAATTTCTCACCCAAATTTCCTCAATTCTCAAGAAACAGGACCACTTGGTCGTGGGTTGCAACAGTGGAGGCAGATCACTTAAAGCTTGTGTTGATCTTCTCAATGAAGGTTTCCAGCATGTGACGAACATGGAGGGGGGCTACTCTGCATGGGTGGACAGTGAACTTGCCCATGACAAACCCACTGAAGACTTAAAAGTCGCTTGCAAGTTCCGTCCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009636 GO:0016491 GO:0030611 GO:0042221 GO:0046685 GO:0050896 GO:0055114 GO:0071722 GO:0098754

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rhodanese

Protein Analysis

136

Amino Acids

14.98

Weight (kDa)

6.19

Isoelectric Point (pI)

39.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013561)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21045
fragaria_vesca	FvH4_6g39880 FvH4_6g39880
malus_domestica	MD09G1135800.v1.1
prunus_persica	Prupe.3G190900_v2.0.a1
pyrus_communis	pycom09g05680
rosa_chinensis	RchiOBHm_Chr2g0154401
rosa_laevigata	RLG00000020775
rosa_multiflora	Rmu_sc0003808.1_g000009 Rmu_sc0025687.1_g000004 Rmu_sc0032891.1_g000001
rosa_roxburghii	Rroxscaffold_2G00094360
rosa_rugosa	Rorug02G0444200
rosa_samantha	Rh2AG508500 Rh2BG519800 Rh2CG494000 Rh2DG530000
rosa_wichuraiana	Rw2G041760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	233, 383
AatII	GACGTC	1 cut(s)	45
AccI	GTMKAC	2 cut(s)	39, 45
AciI	CCGC	1 cut(s)	51
AcsI	RAATTY	2 cut(s)	188, 201
AcuI	CTGAAG	1 cut(s)	393
AcyI	GRCGYC	1 cut(s)	42
AfiI	CCNNNNNNNGG	2 cut(s)	15, 85
AflIII	ACRYGT	1 cut(s)	150
AgsI	TTSAA	3 cut(s)	112, 128, 139
AjnI	CCWGG	1 cut(s)	19
AluBI	AGCT	1 cut(s)	272
AluI	AGCT	1 cut(s)	272
Alw26I	GTCTC	1 cut(s)	65
AoxI	GGCC	1 cut(s)	17
ApeKI	GCWGC	1 cut(s)	5
ApoI	RAATTY	2 cut(s)	188, 201
AspS9I	GGNCC	2 cut(s)	96, 226
AsuHPI	GGTGA	2 cut(s)	68, 187
AvaII	GGWCC	2 cut(s)	96, 226
BbsI	GAAGAC	1 cut(s)	381
BbvCI	CCTCAGC	1 cut(s)	65
BciT130I	CCWGG	1 cut(s)	21
BcoDI	GTCTC	1 cut(s)	65
BisI	GCNGC	1 cut(s)	6
BlsI	GCNGC	1 cut(s)	7
Bme1390I	CCNGG	1 cut(s)	21
Bme18I	GGWCC	2 cut(s)	96, 226
BmgT120I	GGNCC	2 cut(s)	96, 226
BmrFI	CCNGG	1 cut(s)	21
BpiI	GAAGAC	1 cut(s)	381
BpmI	CTGGAG	1 cut(s)	42
Bpu10I	CCTNAGC	1 cut(s)	65
BpuEI	CTTGAG	1 cut(s)	200
BsaHI	GRCGYC	1 cut(s)	42
BsaI	GGTCTC	1 cut(s)	65
Bsc4I	CCNNNNNNNGG	2 cut(s)	15, 85
BseBI	CCWGG	1 cut(s)	21
BseGI	GGATG	1 cut(s)	94
BseLI	CCNNNNNNNGG	2 cut(s)	15, 85
BseMII	CTCAG	1 cut(s)	79
BseRI	GAGGAG	2 cut(s)	53, 119
BshFI	GGCC	1 cut(s)	19
BslI	CCNNNNNNNGG	2 cut(s)	15, 85
BsmAI	GTCTC	1 cut(s)	65
BsnI	GGCC	1 cut(s)	19
Bso31I	GGTCTC	1 cut(s)	65
Bsp143I	GATC	2 cut(s)	260, 280
BspACI	CCGC	1 cut(s)	51
BspANI	GGCC	1 cut(s)	19
BspCNI	CTCAG	1 cut(s)	78
BspTNI	GGTCTC	1 cut(s)	65
BssMI	GATC	2 cut(s)	260, 280
BssNI	GRCGYC	1 cut(s)	42
Bst2UI	CCWGG	1 cut(s)	21
Bst4CI	ACNGT	4 cut(s)	80, 100, 251, 347
BstACI	GRCGYC	1 cut(s)	42
BstC8I	GCNNGC	2 cut(s)	34, 391
BstDEI	CTNAG	1 cut(s)	65
BstEII	GGTNACC	1 cut(s)	74
BstF5I	GGATG	1 cut(s)	94
BstKTI	GATC	2 cut(s)	263, 283
BstMAI	GTCTC	1 cut(s)	65
BstMBI	GATC	2 cut(s)	260, 280
BstNI	CCWGG	1 cut(s)	21
BstNSI	RCATGY	2 cut(s)	154, 308
BstPI	GGTNACC	1 cut(s)	74
BstSCI	CCNGG	1 cut(s)	19
BstV2I	GAAGAC	1 cut(s)	381
BsuRI	GGCC	1 cut(s)	19
BtsCI	GGATG	1 cut(s)	94
BtsIMutI	CAGTG	3 cut(s)	256, 352, 369
Cac8I	GCNNGC	2 cut(s)	34, 391
Cfr13I	GGNCC	2 cut(s)	96, 226
CseI	GACGC	1 cut(s)	25
CviAII	CATG	5 cut(s)	151, 305, 316, 336, 359
CviJI	RGCY	5 cut(s)	5, 19, 120, 272, 327
CviKI_1	RGCY	5 cut(s)	5, 19, 120, 272, 327
DdeI	CTNAG	1 cut(s)	65
DpnI	GATC	2 cut(s)	262, 282
DpnII	GATC	2 cut(s)	260, 280
DrdI	GACNNNNNNGTC	2 cut(s)	233, 383
DseDI	GACNNNNNNGTC	2 cut(s)	233, 383
Eco147I	AGGCCT	1 cut(s)	19
Eco31I	GGTCTC	1 cut(s)	65
Eco47I	GGWCC	2 cut(s)	96, 226
Eco57I	CTGAAG	1 cut(s)	393
Eco91I	GGTNACC	1 cut(s)	74
EcoO65I	GGTNACC	1 cut(s)	74
EcoRII	CCWGG	1 cut(s)	19
FaeI	CATG	5 cut(s)	154, 308, 319, 339, 362
FaiI	YATR	5 cut(s)	152, 306, 317, 337, 360
FatI	CATG	5 cut(s)	150, 304, 315, 335, 358
FblI	GTMKAC	2 cut(s)	39, 45
Fnu4HI	GCNGC	1 cut(s)	6
FokI	GGATG	1 cut(s)	101
Fsp4HI	GCNGC	1 cut(s)	6
GluI	GCNGC	1 cut(s)	6
GsuI	CTGGAG	1 cut(s)	42
HaeIII	GGCC	1 cut(s)	19
HgaI	GACGC	1 cut(s)	25
Hin1I	GRCGYC	1 cut(s)	42
Hin1II	CATG	5 cut(s)	154, 308, 319, 339, 362
HincII	GTYRAC	1 cut(s)	40
HindII	GTYRAC	1 cut(s)	40
HindIII	AAGCTT	1 cut(s)	270
HphI	GGTGA	2 cut(s)	68, 187
Hpy166II	GTNNAC	4 cut(s)	40, 46, 343, 350
Hpy188III	TCNNGA	3 cut(s)	86, 94, 217
Hpy8I	GTNNAC	4 cut(s)	40, 46, 343, 350
Hpy99I	CGWCG	2 cut(s)	41, 44
HpyAV	CCTTC	2 cut(s)	161, 287
HpyCH4III	ACNGT	4 cut(s)	80, 100, 251, 347
HpyCH4IV	ACGT	2 cut(s)	42, 123
HpyCH4V	TGCA	3 cut(s)	246, 335, 393
HpyF3I	CTNAG	1 cut(s)	65
HpySE526I	ACGT	2 cut(s)	42, 123
Hsp92I	GRCGYC	1 cut(s)	42
Hsp92II	CATG	5 cut(s)	154, 308, 319, 339, 362
Kzo9I	GATC	2 cut(s)	260, 280
LpnPI	CCDG	8 cut(s)	6, 33, 46, 71, 79, 198, 209, 314
MaeII	ACGT	2 cut(s)	42, 123
MaeIII	GTNAC	2 cut(s)	74, 307
MalI	GATC	2 cut(s)	262, 282
MboI	GATC	2 cut(s)	260, 280
MboII	GAAGA	3 cut(s)	176, 275, 386
MluCI	AATT	3 cut(s)	188, 201, 210
MnlI	CCTC	5 cut(s)	74, 97, 217, 248, 313
MseI	TTAA	2 cut(s)	267, 380
MspR9I	CCNGG	1 cut(s)	21
MvaI	CCWGG	1 cut(s)	21
NdeII	GATC	2 cut(s)	260, 280
NlaIII	CATG	5 cut(s)	154, 308, 319, 339, 362
NmuCI	GTSAC	2 cut(s)	74, 307
NspI	RCATGY	2 cut(s)	154, 308
PceI	AGGCCT	1 cut(s)	19
PciI	ACATGT	1 cut(s)	150
PkrI	GCNGC	1 cut(s)	7
PscI	ACATGT	1 cut(s)	150
Psp6I	CCWGG	1 cut(s)	19
PspEI	GGTNACC	1 cut(s)	74
PspGI	CCWGG	1 cut(s)	19
PspPI	GGNCC	2 cut(s)	96, 226
PsrI	GAACNNNNNNTAC	2 cut(s)	131, 163
SalI	GTCGAC	1 cut(s)	38
SaqAI	TTAA	2 cut(s)	267, 380
SatI	GCNGC	1 cut(s)	6
Sau3AI	GATC	2 cut(s)	260, 280
Sau96I	GGNCC	2 cut(s)	96, 226
ScrFI	CCNGG	1 cut(s)	21
SetI	ASST	7 cut(s)	45, 61, 76, 126, 172, 274, 298
SgrDI	CGTCGACG	1 cut(s)	38
SinI	GGWCC	2 cut(s)	96, 226
SmlI	CTYRAG	1 cut(s)	215
SmoI	CTYRAG	1 cut(s)	215
Sse9I	AATT	3 cut(s)	188, 201, 210
SseBI	AGGCCT	1 cut(s)	19
SsiI	CCGC	1 cut(s)	51
StuI	AGGCCT	1 cut(s)	19
StyD4I	CCNGG	1 cut(s)	19
TaaI	ACNGT	4 cut(s)	80, 100, 251, 347
TaiI	ACGT	2 cut(s)	45, 126
TaqI	TCGA	1 cut(s)	39
TasI	AATT	3 cut(s)	188, 201, 210
Tru1I	TTAA	2 cut(s)	267, 380
Tru9I	TTAA	2 cut(s)	267, 380
TscAI	CASTG	3 cut(s)	256, 352, 376
TseFI	GTSAC	2 cut(s)	74, 307
TseI	GCWGC	1 cut(s)	5
Tsp45I	GTSAC	2 cut(s)	74, 307
TspDTI	ATGAA	2 cut(s)	145, 306
TspGWI	ACGGA	1 cut(s)	389
TspRI	CASTG	3 cut(s)	256, 352, 376
VpaK11BI	GGWCC	2 cut(s)	96, 226
XapI	RAATTY	2 cut(s)	188, 201
XceI	RCATGY	2 cut(s)	154, 308
XmiI	GTMKAC	2 cut(s)	39, 45
ZraI	GACGTC	1 cut(s)	43

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.