Prupe.6G170100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
17540587 .. 17540811
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G170100.1

Sequence Viewer

Length: 225 bp
AGCGTTTCAGGGTGGCACCGACCCATTATCCTTCCACTGCCCGGAGCGGGAGGTGATCGTTGCTCTGTGAAGCCAGCCTTACGCAATTCCCTCCACTCTAGGAACCATGAAGCCCAGAGCCTTCGCCCAAGCCACATGGCCCAACTTCTGGCTTGGAATGGGCAGGTCAGAATAGAGCCACTCCAAACCGACCCACTATATTGGGCCAATGTTCCAACACCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.2

Weight (kDa)

10.02

Isoelectric Point (pI)

60.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019790)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 154
AccB1I GGYRCC 1 cut(s) 15
AccB7I CCANNNNNTGG 1 cut(s) 148
AccBSI CCGCTC 1 cut(s) 47
AciI CCGC 1 cut(s) 47
AfiI CCNNNNNNNGG 3 cut(s) 41, 47, 148
AoxI GGCC 2 cut(s) 138, 204
AspS9I GGNCC 2 cut(s) 139, 204
AsuC2I CCSGG 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 65
BanI GGYRCC 1 cut(s) 15
BcnI CCSGG 1 cut(s) 42
BfaI CTAG 1 cut(s) 99
BfuAI ACCTGC 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 42
BmgT120I GGNCC 2 cut(s) 139, 204
BmiI GGNNCC 2 cut(s) 17, 104
BmrFI CCNGG 1 cut(s) 42
BpuMI CCSGG 1 cut(s) 42
Bsc4I CCNNNNNNNGG 3 cut(s) 41, 47, 148
BseLI CCNNNNNNNGG 3 cut(s) 41, 47, 148
BshFI GGCC 2 cut(s) 140, 206
BshNI GGYRCC 1 cut(s) 15
BsiSI CCGG 1 cut(s) 42
BslI CCNNNNNNNGG 3 cut(s) 41, 47, 148
BsnI GGCC 2 cut(s) 140, 206
Bsp143I GATC 1 cut(s) 55
BspACI CCGC 1 cut(s) 47
BspANI GGCC 2 cut(s) 140, 206
BspLI GGNNCC 2 cut(s) 17, 104
BspMI ACCTGC 1 cut(s) 154
BspT107I GGYRCC 1 cut(s) 15
BsrBI CCGCTC 1 cut(s) 47
BssMI GATC 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 75
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 40
BstXI CCANNNNNNTGG 1 cut(s) 201
BsuRI GGCC 2 cut(s) 140, 206
BtsI GCAGTG 1 cut(s) 35
BtsIMutI CAGTG 1 cut(s) 35
BveI ACCTGC 1 cut(s) 154
Cac8I GCNNGC 1 cut(s) 75
Cfr13I GGNCC 2 cut(s) 139, 204
CviAII CATG 2 cut(s) 107, 136
CviJI RGCY 9 cut(s) 73, 77, 113, 120, 132, 140, 152, 178, 206
CviKI_1 RGCY 9 cut(s) 73, 77, 113, 120, 132, 140, 152, 178, 206
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
FaeI CATG 2 cut(s) 110, 139
FaiI YATR 3 cut(s) 108, 137, 199
FalI AAGNNNNNCTT 2 cut(s) 62, 94
FatI CATG 2 cut(s) 106, 135
FauI CCCGC 1 cut(s) 40
FspBI CTAG 1 cut(s) 99
HaeIII GGCC 2 cut(s) 140, 206
HapII CCGG 1 cut(s) 42
Hin1II CATG 2 cut(s) 110, 139
HpaII CCGG 1 cut(s) 42
HphI GGTGA 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 170
HpyAV CCTTC 2 cut(s) 41, 131
Hsp92II CATG 2 cut(s) 110, 139
Kzo9I GATC 1 cut(s) 55
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 5 cut(s) 55, 87, 128, 134, 149
MaeI CTAG 1 cut(s) 99
MalI GATC 1 cut(s) 57
MbiI CCGCTC 1 cut(s) 47
MboI GATC 1 cut(s) 55
MluCI AATT 1 cut(s) 85
MnlI CCTC 2 cut(s) 44, 101
MseI TTAA 1 cut(s) 223
MspI CCGG 1 cut(s) 42
MspR9I CCNGG 1 cut(s) 42
NciI CCSGG 1 cut(s) 42
NdeII GATC 1 cut(s) 55
NlaIII CATG 2 cut(s) 110, 139
NlaIV GGNNCC 2 cut(s) 17, 104
PflMI CCANNNNNTGG 1 cut(s) 148
PspN4I GGNNCC 2 cut(s) 17, 104
PspPI GGNCC 2 cut(s) 139, 204
SaqAI TTAA 1 cut(s) 223
Sau3AI GATC 1 cut(s) 55
Sau96I GGNCC 2 cut(s) 139, 204
ScrFI CCNGG 1 cut(s) 42
SetI ASST 3 cut(s) 55, 168, 223
Sse9I AATT 1 cut(s) 85
SsiI CCGC 1 cut(s) 47
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 40
TasI AATT 1 cut(s) 85
Tru1I TTAA 1 cut(s) 223
Tru9I TTAA 1 cut(s) 223
TscAI CASTG 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 123
TspRI CASTG 1 cut(s) 42
Van91I CCANNNNNTGG 1 cut(s) 148
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.