Prupe.6G200500_v2.0.a1

Domain of unknown function (DUF4408)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
20804796 .. 20807344
2549 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G200500.1

Sequence Viewer

Length: 573 bp
ATGGAGCCGTGGCTCGACGACTTAGCCGACGACCTCCAGAGCCTGAGCTTCACCTCCACCACAACTGTGTTGGTAACAGGTAAGCCCGAAGGCTGTTCCCGTCCCTCGTCTCCAAGCTTCCACCACACCCTCTCGCCAACTCCTCGGACCCTCTCTGGTCCGCCATCCACAAAACCCTCTAGCCTTCGCCTTCGCCTTCGCCATCGCCATCACCGTCGTCGACGGCGTCGGCACCAGCCTTGGTCCTGTCCAACTCCGGCAAGCGCATGGACCAGGCGGGGAAAGAAGAAGCTTCCTCTGTGGTTGCCTCTGGTCAAGAACTCTGGCTTCTACTTCCAGGACATATCAGGCTTCGTGGTTAGCCCTCGCTTCGTGTTCGTAGTTGGAAATATAATTGTCATCATTCTCCTTGTCAAGTCCGGCAAGTTTTCAGGTAAAGACTCCAGCACAGGAGCTGATCTTTACGATGAGTTTGTTCACAACAGCGAAAAGAACCATGAAATGGTCATGACCCATTTTCCGATTCCACGACTCGGGCGAGTCGGTGGTCATGAACTCGATCTCATCCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

191

Amino Acids

21.47

Weight (kDa)

10.41

Isoelectric Point (pI)

66.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014184)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 231
AccB7I CCANNNNNTGG 1 cut(s) 502
AccI GTMKAC 1 cut(s) 220
AciI CCGC 2 cut(s) 161, 277
AcyI GRCGYC 1 cut(s) 226
AfiI CCNNNNNNNGG 2 cut(s) 502, 533
AjnI CCWGG 2 cut(s) 272, 336
AleI CACNNNNGTG 1 cut(s) 65
AluBI AGCT 4 cut(s) 48, 117, 292, 455
AluI AGCT 4 cut(s) 48, 117, 292, 455
Alw26I GTCTC 1 cut(s) 114
AlwNI CAGNNNCTG 2 cut(s) 43, 455
Ama87I CYCGRG 1 cut(s) 533
AspLEI GCGC 1 cut(s) 266
AspS9I GGNCC 4 cut(s) 147, 158, 243, 270
AsuHPI GGTGA 2 cut(s) 43, 203
AvaI CYCGRG 1 cut(s) 533
AvaII GGWCC 4 cut(s) 147, 158, 243, 270
BanI GGYRCC 1 cut(s) 231
BccI CCATC 3 cut(s) 172, 210, 216
BceAI ACGGC 1 cut(s) 239
BciT130I CCWGG 2 cut(s) 274, 338
BcoDI GTCTC 1 cut(s) 114
BfaI CTAG 1 cut(s) 180
Bme1390I CCNGG 2 cut(s) 274, 338
Bme18I GGWCC 4 cut(s) 147, 158, 243, 270
BmeT110I CYCGRG 1 cut(s) 533
BmgT120I GGNCC 4 cut(s) 147, 158, 243, 270
BmiI GGNNCC 3 cut(s) 6, 149, 233
BmrFI CCNGG 2 cut(s) 274, 338
BpmI CTGGAG 2 cut(s) 20, 427
Bpu10I CCTNAGC 1 cut(s) 44
BsaHI GRCGYC 1 cut(s) 226
BsaJI CCNNGG 3 cut(s) 8, 143, 239
Bsc4I CCNNNNNNNGG 2 cut(s) 502, 533
BseBI CCWGG 2 cut(s) 274, 338
BseDI CCNNGG 3 cut(s) 8, 143, 239
BseGI GGATG 2 cut(s) 164, 564
BseLI CCNNNNNNNGG 2 cut(s) 502, 533
BseMII CTCAG 1 cut(s) 35
BseRI GAGGAG 1 cut(s) 132
BshNI GGYRCC 1 cut(s) 231
BsiHKCI CYCGRG 1 cut(s) 533
BsiSI CCGG 2 cut(s) 257, 420
BslFI GGGAC 1 cut(s) 87
BslI CCNNNNNNNGG 2 cut(s) 502, 533
BsmAI GTCTC 1 cut(s) 114
BsmBI CGTCTC 1 cut(s) 114
BsmFI GGGAC 1 cut(s) 87
BsoBI CYCGRG 1 cut(s) 533
Bsp143I GATC 2 cut(s) 457, 559
BspACI CCGC 2 cut(s) 161, 277
BspCNI CTCAG 1 cut(s) 36
BspHI TCATGA 2 cut(s) 507, 550
BspLI GGNNCC 3 cut(s) 6, 149, 233
BspT107I GGYRCC 1 cut(s) 231
BssECI CCNNGG 3 cut(s) 8, 143, 239
BssMI GATC 2 cut(s) 457, 559
BssNI GRCGYC 1 cut(s) 226
BssT1I CCWWGG 1 cut(s) 239
Bst2UI CCWGG 2 cut(s) 274, 338
Bst4CI ACNGT 2 cut(s) 67, 215
BstACI GRCGYC 1 cut(s) 226
BstC8I GCNNGC 1 cut(s) 262
BstDEI CTNAG 2 cut(s) 22, 44
BstDSI CCRYGG 1 cut(s) 8
BstF5I GGATG 2 cut(s) 164, 564
BstHHI GCGC 1 cut(s) 266
BstKTI GATC 2 cut(s) 460, 562
BstMAI GTCTC 1 cut(s) 114
BstMBI GATC 2 cut(s) 457, 559
BstNI CCWGG 2 cut(s) 274, 338
BstSCI CCNGG 2 cut(s) 272, 336
BtgI CCRYGG 1 cut(s) 8
BtgZI GCGATG 1 cut(s) 188
BtsCI GGATG 2 cut(s) 164, 564
Cac8I GCNNGC 1 cut(s) 262
CaiI CAGNNNCTG 2 cut(s) 43, 455
CciI TCATGA 2 cut(s) 507, 550
CfoI GCGC 1 cut(s) 266
Cfr13I GGNCC 4 cut(s) 147, 158, 243, 270
CseI GACGC 1 cut(s) 215
CviAII CATG 4 cut(s) 267, 497, 508, 551
DdeI CTNAG 2 cut(s) 22, 44
DpnI GATC 2 cut(s) 459, 561
DpnII GATC 2 cut(s) 457, 559
EciI GGCGGA 1 cut(s) 150
Eco130I CCWWGG 1 cut(s) 239
Eco47I GGWCC 4 cut(s) 147, 158, 243, 270
Eco88I CYCGRG 1 cut(s) 533
EcoRII CCWGG 2 cut(s) 272, 336
EcoT14I CCWWGG 1 cut(s) 239
ErhI CCWWGG 1 cut(s) 239
Esp3I CGTCTC 1 cut(s) 114
FaeI CATG 4 cut(s) 270, 500, 511, 554
FaiI YATR 6 cut(s) 268, 344, 392, 498, 509, 552
FaqI GGGAC 1 cut(s) 87
FatI CATG 4 cut(s) 266, 496, 507, 550
FauI CCCGC 1 cut(s) 270
FblI GTMKAC 1 cut(s) 220
FokI GGATG 2 cut(s) 151, 551
FspBI CTAG 1 cut(s) 180
GlaI GCGC 1 cut(s) 265
GsuI CTGGAG 2 cut(s) 20, 427
HapII CCGG 2 cut(s) 257, 420
HgaI GACGC 1 cut(s) 215
HhaI GCGC 1 cut(s) 266
Hin1I GRCGYC 1 cut(s) 226
Hin1II CATG 4 cut(s) 270, 500, 511, 554
Hin6I GCGC 1 cut(s) 264
HinP1I GCGC 1 cut(s) 264
HincII GTYRAC 1 cut(s) 221
HindII GTYRAC 1 cut(s) 221
HindIII AAGCTT 2 cut(s) 115, 290
HinfI GANTC 4 cut(s) 440, 523, 531, 540
HpaII CCGG 2 cut(s) 257, 420
HphI GGTGA 2 cut(s) 43, 203
Hpy166II GTNNAC 2 cut(s) 221, 478
Hpy188I TCNGA 2 cut(s) 147, 522
Hpy188III TCNNGA 4 cut(s) 37, 316, 508, 551
Hpy8I GTNNAC 2 cut(s) 221, 478
Hpy99I CGWCG 6 cut(s) 20, 32, 219, 222, 225, 231
HpyAV CCTTC 4 cut(s) 83, 194, 200, 206
HpyCH4III ACNGT 2 cut(s) 67, 215
HpyF3I CTNAG 2 cut(s) 22, 44
Hsp92I GRCGYC 1 cut(s) 226
Hsp92II CATG 4 cut(s) 270, 500, 511, 554
HspAI GCGC 1 cut(s) 264
Kzo9I GATC 2 cut(s) 457, 559
LmnI GCTCC 2 cut(s) 4, 452
MaeI CTAG 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 73
MalI GATC 2 cut(s) 459, 561
MboI GATC 2 cut(s) 457, 559
MboII GAAGA 1 cut(s) 298
MluCI AATT 1 cut(s) 393
MlyI GAGTC 3 cut(s) 434, 525, 549
MmeI TCCRAC 2 cut(s) 275, 364
MslI CAYNNNNRTG 1 cut(s) 65
MspI CCGG 2 cut(s) 257, 420
MspR9I CCNGG 2 cut(s) 274, 338
MvaI CCWGG 2 cut(s) 274, 338
NdeII GATC 2 cut(s) 457, 559
NlaIII CATG 4 cut(s) 270, 500, 511, 554
NlaIV GGNNCC 3 cut(s) 6, 149, 233
OliI CACNNNNGTG 1 cut(s) 65
PagI TCATGA 2 cut(s) 507, 550
PcsI WCGNNNNNNNCGW 4 cut(s) 24, 211, 223, 535
PfeI GAWTC 1 cut(s) 523
PflFI GACNNNGTC 1 cut(s) 225
PflMI CCANNNNNTGG 1 cut(s) 502
PfoI TCCNGGA 1 cut(s) 336
PleI GAGTC 3 cut(s) 434, 525, 548
PpsI GAGTC 3 cut(s) 434, 525, 548
Psp6I CCWGG 2 cut(s) 272, 336
PspGI CCWGG 2 cut(s) 272, 336
PspN4I GGNNCC 3 cut(s) 6, 149, 233
PspPI GGNCC 4 cut(s) 147, 158, 243, 270
PstNI CAGNNNCTG 2 cut(s) 43, 455
PsyI GACNNNGTC 1 cut(s) 225
RseI CAYNNNNRTG 1 cut(s) 65
SalI GTCGAC 1 cut(s) 219
Sau3AI GATC 2 cut(s) 457, 559
Sau96I GGNCC 4 cut(s) 147, 158, 243, 270
SchI GAGTC 3 cut(s) 434, 525, 549
ScrFI CCNGG 2 cut(s) 274, 338
SetI ASST 8 cut(s) 36, 50, 56, 82, 119, 294, 436, 457
SgrDI CGTCGACG 1 cut(s) 219
SinI GGWCC 4 cut(s) 147, 158, 243, 270
SmiMI CAYNNNNRTG 1 cut(s) 65
Sse9I AATT 1 cut(s) 393
SsiI CCGC 2 cut(s) 161, 277
SspMI CTAG 1 cut(s) 180
StyD4I CCNGG 2 cut(s) 272, 336
StyI CCWWGG 1 cut(s) 239
TaaI ACNGT 2 cut(s) 67, 215
TaqI TCGA 3 cut(s) 15, 220, 558
TasI AATT 1 cut(s) 393
TfiI GAWTC 1 cut(s) 523
TspDTI ATGAA 2 cut(s) 513, 567
Tth111I GACNNNGTC 1 cut(s) 225
Van91I CCANNNNNTGG 1 cut(s) 502
VpaK11BI GGWCC 4 cut(s) 147, 158, 243, 270
XcmI CCANNNNNNNNNTGG 1 cut(s) 67
XmiI GTMKAC 1 cut(s) 220
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.