Prupe.6G306400_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0018454
Physical Location & Seq
Reverse (-)
27642426 .. 27642820
395 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G306400.1

Sequence Viewer

Length: 303 bp
ATGGAGAGAGTGAATAAGGTGATGCTGATCCTGACCACTATCCTAGTGGTTGCTGCATTGCATGTTGAAGGAGGAAGGCGGATCAAGAGTCATGATGAGAATGGAGAGGGCGTTGATGAGCCTCAGAACTTCTATGGAGGAGCTGCAGGAGGCATCTTCCCAGGCCCTCCAGGGTTTGTTACTGGGGTTAGCTTTGGACCATCAGGCCTCTGCACTCTCCCTGGAGGCTGTGTTCCAGTCCCAGTCCTCCCCACTATCCCTGCTGTTCCTTCTGCTGGTGGCTCAGTCCCATTTACACCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

10.08

Weight (kDa)

5.48

Isoelectric Point (pI)

53.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018454)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g08340
malus_domestica MD12G1201300.v1.1
prunus_persica Prupe.6G306400_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0458221
rosa_roxburghii Rroxscaffold_6G00421210
rosa_rugosa Rorug03G0025500
rosa_samantha Rh3AG086300 Rh3BG089000 Rh3CG089600 Rh3DG090100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclWI GGATC 2 cut(s) 22, 89
AfiI CCNNNNNNNGG 1 cut(s) 275
AgsI TTSAA 1 cut(s) 68
AjnI CCWGG 3 cut(s) 160, 169, 220
AloI GAACNNNNNNTCC 2 cut(s) 216, 248
AluBI AGCT 2 cut(s) 143, 192
AluI AGCT 2 cut(s) 143, 192
AlwI GGATC 2 cut(s) 22, 89
AoxI GGCC 2 cut(s) 163, 205
ApeKI GCWGC 2 cut(s) 53, 143
AspS9I GGNCC 2 cut(s) 164, 197
AsuHPI GGTGA 1 cut(s) 31
AvaII GGWCC 1 cut(s) 197
BbvI GCAGC 2 cut(s) 40, 130
BccI CCATC 1 cut(s) 208
BciT130I CCWGG 3 cut(s) 162, 171, 222
BfaI CTAG 1 cut(s) 44
BfmI CTRYAG 1 cut(s) 144
BisI GCNGC 2 cut(s) 54, 144
BlsI GCNGC 2 cut(s) 55, 145
Bme1390I CCNGG 3 cut(s) 162, 171, 222
Bme18I GGWCC 1 cut(s) 197
BmgT120I GGNCC 2 cut(s) 164, 197
BmrFI CCNGG 3 cut(s) 162, 171, 222
BmrI ACTGGG 2 cut(s) 192, 236
BmsI GCATC 2 cut(s) 12, 162
BmuI ACTGGG 2 cut(s) 192, 236
BpmI CTGGAG 2 cut(s) 153, 243
BsaBI GATNNNNATC 1 cut(s) 26
BsaJI CCNNGG 3 cut(s) 160, 170, 220
BsaXI ACNNNNNCTCC 4 cut(s) 96, 126, 216, 246
Bsc4I CCNNNNNNNGG 1 cut(s) 275
Bse1I ACTGG 3 cut(s) 187, 236, 242
Bse3DI GCAATG 1 cut(s) 56
Bse8I GATNNNNATC 1 cut(s) 26
BseBI CCWGG 3 cut(s) 162, 171, 222
BseDI CCNNGG 3 cut(s) 160, 170, 220
BseJI GATNNNNATC 1 cut(s) 26
BseLI CCNNNNNNNGG 1 cut(s) 275
BseMI GCAATG 1 cut(s) 56
BseMII CTCAG 2 cut(s) 137, 297
BseNI ACTGG 3 cut(s) 187, 236, 242
BseRI GAGGAG 1 cut(s) 153
BseXI GCAGC 2 cut(s) 40, 130
BsgI GTGCAG 1 cut(s) 196
BshFI GGCC 2 cut(s) 165, 207
BslFI GGGAC 2 cut(s) 224, 272
BslI CCNNNNNNNGG 1 cut(s) 275
BsmFI GGGAC 2 cut(s) 224, 272
BsnI GGCC 2 cut(s) 165, 207
Bsp143I GATC 2 cut(s) 27, 81
BspACI CCGC 1 cut(s) 79
BspANI GGCC 2 cut(s) 165, 207
BspCNI CTCAG 2 cut(s) 136, 296
BspHI TCATGA 1 cut(s) 91
BspMAI CTGCAG 1 cut(s) 148
BspPI GGATC 2 cut(s) 22, 89
BsrDI GCAATG 1 cut(s) 56
BsrI ACTGG 3 cut(s) 187, 236, 242
BssECI CCNNGG 3 cut(s) 160, 170, 220
BssMI GATC 2 cut(s) 27, 81
Bst2UI CCWGG 3 cut(s) 162, 171, 222
BstDEI CTNAG 2 cut(s) 123, 283
BstKTI GATC 2 cut(s) 30, 84
BstMBI GATC 2 cut(s) 27, 81
BstNI CCWGG 3 cut(s) 162, 171, 222
BstNSI RCATGY 1 cut(s) 65
BstSCI CCNGG 3 cut(s) 160, 169, 220
BstSFI CTRYAG 1 cut(s) 144
BstV1I GCAGC 2 cut(s) 40, 130
BsuRI GGCC 2 cut(s) 165, 207
CciI TCATGA 1 cut(s) 91
Cfr13I GGNCC 2 cut(s) 164, 197
CviAII CATG 3 cut(s) 62, 92, 300
CviJI RGCY 7 cut(s) 121, 143, 165, 192, 207, 228, 282
CviKI_1 RGCY 7 cut(s) 121, 143, 165, 192, 207, 228, 282
DdeI CTNAG 2 cut(s) 123, 283
DpnI GATC 2 cut(s) 29, 83
DpnII GATC 2 cut(s) 27, 81
EciI GGCGGA 1 cut(s) 94
Eco147I AGGCCT 1 cut(s) 207
Eco47I GGWCC 1 cut(s) 197
EcoO109I RGGNCCY 1 cut(s) 164
EcoRII CCWGG 3 cut(s) 160, 169, 220
FaeI CATG 3 cut(s) 65, 95, 303
FaiI YATR 4 cut(s) 63, 93, 135, 301
FaqI GGGAC 2 cut(s) 224, 272
FatI CATG 3 cut(s) 61, 91, 299
Fnu4HI GCNGC 2 cut(s) 54, 144
Fsp4HI GCNGC 2 cut(s) 54, 144
FspBI CTAG 1 cut(s) 44
GluI GCNGC 2 cut(s) 54, 144
GsuI CTGGAG 2 cut(s) 153, 243
HaeIII GGCC 2 cut(s) 165, 207
Hin1II CATG 3 cut(s) 65, 95, 303
HinfI GANTC 1 cut(s) 88
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 3 cut(s) 31, 85, 92
HpyAV CCTTC 3 cut(s) 62, 69, 279
HpyCH4V TGCA 4 cut(s) 56, 61, 146, 213
HpyF3I CTNAG 2 cut(s) 123, 283
Hsp92II CATG 3 cut(s) 65, 95, 303
Kzo9I GATC 2 cut(s) 27, 81
LmnI GCTCC 1 cut(s) 140
Lsp1109I GCAGC 2 cut(s) 40, 130
LweI GCATC 2 cut(s) 12, 162
MaeI CTAG 1 cut(s) 44
MaeIII GTNAC 1 cut(s) 178
MalI GATC 2 cut(s) 29, 83
MboI GATC 2 cut(s) 27, 81
MboII GAAGA 1 cut(s) 148
MlyI GAGTC 1 cut(s) 97
MnlI CCTC 9 cut(s) 65, 100, 131, 132, 143, 177, 218, 218, 257
MspR9I CCNGG 3 cut(s) 162, 171, 222
MvaI CCWGG 3 cut(s) 162, 171, 222
NdeII GATC 2 cut(s) 27, 81
NlaIII CATG 3 cut(s) 65, 95, 303
NspI RCATGY 1 cut(s) 65
PagI TCATGA 1 cut(s) 91
PceI AGGCCT 1 cut(s) 207
PkrI GCNGC 2 cut(s) 55, 145
PleI GAGTC 1 cut(s) 96
PpsI GAGTC 1 cut(s) 96
Psp6I CCWGG 3 cut(s) 160, 169, 220
PspGI CCWGG 3 cut(s) 160, 169, 220
PspPI GGNCC 2 cut(s) 164, 197
PstI CTGCAG 1 cut(s) 148
SatI GCNGC 2 cut(s) 54, 144
Sau3AI GATC 2 cut(s) 27, 81
Sau96I GGNCC 2 cut(s) 164, 197
SchI GAGTC 1 cut(s) 97
ScrFI CCNGG 3 cut(s) 162, 171, 222
SetI ASST 3 cut(s) 21, 145, 194
SfaNI GCATC 2 cut(s) 12, 162
SfcI CTRYAG 1 cut(s) 144
SinI GGWCC 1 cut(s) 197
SseBI AGGCCT 1 cut(s) 207
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 44
StuI AGGCCT 1 cut(s) 207
StyD4I CCNGG 3 cut(s) 160, 169, 220
TseI GCWGC 2 cut(s) 53, 143
VpaK11BI GGWCC 1 cut(s) 197
XceI RCATGY 1 cut(s) 65
XcmI CCANNNNNNNNNTGG 1 cut(s) 43
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.