Rroxscaffold_6G00421210

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
42431025 .. 42432764
1740 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00421210.1

Sequence Viewer

Length: 312 bp
ATGGAGAGAGTGAGTAAGGTCCTGCTGATGATCCTGACCGTTGTTGCAGTGGTTCTGGCTTTGGGTGTTGAAGCAAGAGTGATGAAGACTAAAGAGCAAGTTGAGCACCCCCAAAACTTCTATGGAGGAGCTGGAGGTGCTTTCTTCCCAGGCTCAGGCCCAGGCTTTGCTACTGGAATTGGGTTTAGCCCATCAGGCTTCTGCACACTCCCTGGTGGATGTGTCCCTACTGCCGGTGGTTTGCCCACTATTCCTGGTGGCTCTATTGGTACTAGTGGCGGTGGTTCAGTTCCAATGATACCACATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

10.2

Weight (kDa)

6.7

Isoelectric Point (pI)

34.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018454)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g08340
malus_domestica MD12G1201300.v1.1
prunus_persica Prupe.6G306400_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0458221
rosa_roxburghii Rroxscaffold_6G00421210
rosa_rugosa Rorug03G0025500
rosa_samantha Rh3AG086300 Rh3BG089000 Rh3CG089600 Rh3DG090100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 279
AclWI GGATC 1 cut(s) 25
AfaI GTAC 1 cut(s) 271
AfiI CCNNNNNNNGG 2 cut(s) 155, 233
AgsI TTSAA 1 cut(s) 71
AhlI ACTAGT 1 cut(s) 272
AjnI CCWGG 4 cut(s) 148, 160, 211, 253
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
Alw21I GWGCWC 1 cut(s) 108
AlwI GGATC 1 cut(s) 25
AoxI GGCC 1 cut(s) 157
AspS9I GGNCC 2 cut(s) 19, 158
AvaII GGWCC 1 cut(s) 19
BbsI GAAGAC 1 cut(s) 92
Bbv12I GWGCWC 1 cut(s) 108
BccI CCATC 1 cut(s) 199
BciT130I CCWGG 4 cut(s) 150, 162, 213, 255
BcuI ACTAGT 1 cut(s) 272
BfaI CTAG 1 cut(s) 273
BglI GCCNNNNNGGC 1 cut(s) 195
Bme1390I CCNGG 4 cut(s) 150, 162, 213, 255
Bme18I GGWCC 1 cut(s) 19
BmgT120I GGNCC 2 cut(s) 19, 158
BmrFI CCNGG 4 cut(s) 150, 162, 213, 255
BpiI GAAGAC 1 cut(s) 92
BpmI CTGGAG 1 cut(s) 153
Bpu10I CCTNAGC 1 cut(s) 154
BsaJI CCNNGG 3 cut(s) 148, 160, 211
Bsc4I CCNNNNNNNGG 2 cut(s) 155, 233
Bse118I RCCGGY 1 cut(s) 233
Bse1I ACTGG 1 cut(s) 178
BseBI CCWGG 4 cut(s) 150, 162, 213, 255
BseDI CCNNGG 3 cut(s) 148, 160, 211
BseGI GGATG 1 cut(s) 224
BseLI CCNNNNNNNGG 2 cut(s) 155, 233
BseMII CTCAG 1 cut(s) 168
BseNI ACTGG 1 cut(s) 178
BseRI GAGGAG 1 cut(s) 141
BsgI GTGCAG 1 cut(s) 187
BshFI GGCC 1 cut(s) 159
BsiHKAI GWGCWC 1 cut(s) 108
BsiSI CCGG 1 cut(s) 234
BslFI GGGAC 1 cut(s) 209
BslI CCNNNNNNNGG 2 cut(s) 155, 233
BsmFI GGGAC 1 cut(s) 209
BsnI GGCC 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 108
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 1 cut(s) 279
BspANI GGCC 1 cut(s) 159
BspCNI CTCAG 1 cut(s) 167
BspPI GGATC 1 cut(s) 25
BsrFI RCCGGY 1 cut(s) 233
BsrI ACTGG 1 cut(s) 178
BssAI RCCGGY 1 cut(s) 233
BssECI CCNNGG 3 cut(s) 148, 160, 211
BssMI GATC 1 cut(s) 30
Bst2UI CCWGG 4 cut(s) 150, 162, 213, 255
Bst4CI ACNGT 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 154
BstF5I GGATG 1 cut(s) 224
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstMWI GCNNNNNNNGC 3 cut(s) 103, 137, 195
BstNI CCWGG 4 cut(s) 150, 162, 213, 255
BstSCI CCNGG 4 cut(s) 148, 160, 211, 253
BstV2I GAAGAC 1 cut(s) 92
BsuRI GGCC 1 cut(s) 159
BtsCI GGATG 1 cut(s) 224
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 54
Cfr10I RCCGGY 1 cut(s) 233
Cfr13I GGNCC 2 cut(s) 19, 158
Csp6I GTAC 1 cut(s) 270
CviAII CATG 1 cut(s) 305
CviJI RGCY 8 cut(s) 59, 131, 153, 159, 165, 189, 198, 261
CviKI_1 RGCY 8 cut(s) 59, 131, 153, 159, 165, 189, 198, 261
CviQI GTAC 1 cut(s) 270
DdeI CTNAG 1 cut(s) 154
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
Eco47I GGWCC 1 cut(s) 19
EcoO109I RGGNCCY 1 cut(s) 19
EcoRII CCWGG 4 cut(s) 148, 160, 211, 253
FaeI CATG 1 cut(s) 308
FaiI YATR 2 cut(s) 123, 306
FaqI GGGAC 1 cut(s) 209
FatI CATG 1 cut(s) 304
FokI GGATG 1 cut(s) 231
FspBI CTAG 1 cut(s) 273
GsuI CTGGAG 1 cut(s) 153
HaeIII GGCC 1 cut(s) 159
HapII CCGG 1 cut(s) 234
Hin1II CATG 1 cut(s) 308
HpaII CCGG 1 cut(s) 234
Hpy188III TCNNGA 1 cut(s) 34
HpyCH4III ACNGT 1 cut(s) 40
HpyCH4V TGCA 2 cut(s) 47, 204
HpyF10VI GCNNNNNNNGC 3 cut(s) 103, 137, 195
HpyF3I CTNAG 1 cut(s) 154
Hsp92II CATG 1 cut(s) 308
Kzo9I GATC 1 cut(s) 30
LmnI GCTCC 1 cut(s) 128
MaeI CTAG 1 cut(s) 273
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MboII GAAGA 2 cut(s) 97, 136
MhlI GDGCHC 1 cut(s) 108
MluCI AATT 1 cut(s) 177
MnlI CCTC 2 cut(s) 119, 128
MspI CCGG 1 cut(s) 234
MspR9I CCNGG 4 cut(s) 150, 162, 213, 255
MvaI CCWGG 4 cut(s) 150, 162, 213, 255
MwoI GCNNNNNNNGC 3 cut(s) 103, 137, 195
NdeII GATC 1 cut(s) 30
NlaIII CATG 1 cut(s) 308
PpuMI RGGWCCY 1 cut(s) 19
Psp5II RGGWCCY 1 cut(s) 19
Psp6I CCWGG 4 cut(s) 148, 160, 211, 253
PspGI CCWGG 4 cut(s) 148, 160, 211, 253
PspPI GGNCC 2 cut(s) 19, 158
PspPPI RGGWCCY 1 cut(s) 19
RsaI GTAC 1 cut(s) 271
RsaNI GTAC 1 cut(s) 270
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 2 cut(s) 19, 158
ScrFI CCNGG 4 cut(s) 150, 162, 213, 255
SduI GDGCHC 1 cut(s) 108
SetI ASST 3 cut(s) 21, 133, 139
SinI GGWCC 1 cut(s) 19
SpeI ACTAGT 1 cut(s) 272
Sse9I AATT 1 cut(s) 177
SsiI CCGC 1 cut(s) 279
SspMI CTAG 1 cut(s) 273
StyD4I CCNGG 4 cut(s) 148, 160, 211, 253
TaaI ACNGT 1 cut(s) 40
TasI AATT 1 cut(s) 177
TscAI CASTG 1 cut(s) 54
TspDTI ATGAA 1 cut(s) 98
TspRI CASTG 1 cut(s) 54
VpaK11BI GGWCC 1 cut(s) 19
XcmI CCANNNNNNNNNTGG 1 cut(s) 119
XspI CTAG 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.