Prupe.7G032300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
5968347 .. 5969878
1532 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G032300.1

Sequence Viewer

Length: 183 bp
ATGCCAAATAGAACTCGACCTATGACTGCACTCTTGGTGTTTACTGGGCTGAATATTGTACTAGTTTCAACCATTACTCCAGTCTATGATTTTGTCTGCTTCCTTCCATACTGGGAAAGAAGGAGAGAACGACGTCGTCAGGAACGTGAAGCAATTTTGTCAAATGGTCCTGAATCAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.13

Weight (kDa)

10.24

Isoelectric Point (pI)

80.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018339)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G09225
malus_domestica MD00G1018100.v1.1 MD12G1095600.v1.1
prunus_persica Prupe.7G032300_v2.0.a1
pyrus_communis pycom12g08250
rosa_chinensis RchiOBHm_Chr1g0328411 RchiOBHm_Chr1g0328511
rosa_roxburghii Rroxscaffold_4G00321620
rosa_wichuraiana Rw1G007230 Rw1G007260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 136
AcyI GRCGYC 1 cut(s) 133
AfaI GTAC 1 cut(s) 60
AgsI TTSAA 1 cut(s) 69
AhlI ACTAGT 1 cut(s) 61
AspS9I GGNCC 1 cut(s) 167
AvaII GGWCC 1 cut(s) 167
BcuI ACTAGT 1 cut(s) 61
BfaI CTAG 1 cut(s) 62
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BmrI ACTGGG 2 cut(s) 54, 121
BmuI ACTGGG 2 cut(s) 54, 121
BpmI CTGGAG 1 cut(s) 63
BsaHI GRCGYC 1 cut(s) 133
BsaXI ACNNNNNCTCC 2 cut(s) 61, 91
Bse1I ACTGG 3 cut(s) 49, 80, 116
BseNI ACTGG 3 cut(s) 49, 80, 116
BsgI GTGCAG 1 cut(s) 12
BsrI ACTGG 3 cut(s) 49, 80, 116
BssNI GRCGYC 1 cut(s) 133
BstACI GRCGYC 1 cut(s) 133
Cfr13I GGNCC 1 cut(s) 167
Csp6I GTAC 1 cut(s) 59
CviJI RGCY 1 cut(s) 49
CviKI_1 RGCY 1 cut(s) 49
CviQI GTAC 1 cut(s) 59
Eco47I GGWCC 1 cut(s) 167
FaiI YATR 3 cut(s) 23, 87, 109
FspBI CTAG 1 cut(s) 62
GsuI CTGGAG 1 cut(s) 63
Hin1I GRCGYC 1 cut(s) 133
HinfI GANTC 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 42
Hpy188III TCNNGA 2 cut(s) 140, 170
Hpy8I GTNNAC 1 cut(s) 42
Hpy99I CGWCG 2 cut(s) 135, 138
HpyAV CCTTC 2 cut(s) 113, 114
HpyCH4IV ACGT 2 cut(s) 133, 145
HpyCH4V TGCA 1 cut(s) 29
HpySE526I ACGT 2 cut(s) 133, 145
Hsp92I GRCGYC 1 cut(s) 133
LpnPI CCDG 4 cut(s) 30, 93, 97, 125
MaeI CTAG 1 cut(s) 62
MaeII ACGT 2 cut(s) 133, 145
MluCI AATT 1 cut(s) 153
PcsI WCGNNNNNNNCGW 1 cut(s) 142
PfeI GAWTC 1 cut(s) 173
PflFI GACNNNGTC 1 cut(s) 135
PspPI GGNCC 1 cut(s) 167
PsyI GACNNNGTC 1 cut(s) 135
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
Sau96I GGNCC 1 cut(s) 167
SetI ASST 3 cut(s) 22, 136, 148
SgeI CNNG 8 cut(s) 27, 46, 57, 74, 92, 124, 152, 158
SinI GGWCC 1 cut(s) 167
SpeI ACTAGT 1 cut(s) 61
Sse9I AATT 1 cut(s) 153
SspI AATATT 1 cut(s) 55
SspMI CTAG 1 cut(s) 62
TaiI ACGT 2 cut(s) 136, 148
TaqI TCGA 1 cut(s) 16
TasI AATT 1 cut(s) 153
TatI WGTACW 1 cut(s) 58
TfiI GAWTC 1 cut(s) 173
Tth111I GACNNNGTC 1 cut(s) 135
VpaK11BI GGWCC 1 cut(s) 167
XspI CTAG 1 cut(s) 62
ZraI GACGTC 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.