RchiOBHm_Chr1g0328511

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
17909034 .. 17914683
5650 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55793

Sequence Viewer

Length: 183 bp
ATGCCACATAGAACTCGACCGATGACTGCACTTTTGGTGTTTACTGGACTGAATGCTATCCTAGTTTCAACCATTACTCCTGTCTATGATTTCGCCTGCTTTCTTCCTTTTTGGGAAAGACGGAGGGAACAACTTCGTCAGGAACATGAAGCTACTTTATTTAAGAGTTTGGAATCAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.12

Weight (kDa)

9.29

Isoelectric Point (pI)

73.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018339)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G09225
malus_domestica MD00G1018100.v1.1 MD12G1095600.v1.1
prunus_persica Prupe.7G032300_v2.0.a1
pyrus_communis pycom12g08250
rosa_chinensis RchiOBHm_Chr1g0328411 RchiOBHm_Chr1g0328511
rosa_roxburghii Rroxscaffold_4G00321620
rosa_wichuraiana Rw1G007230 Rw1G007260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 69
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
ArsI GACNNNNNNTTYG 2 cut(s) 16, 48
Asp700I GAANNNNTTC 1 cut(s) 132
BfaI CTAG 1 cut(s) 62
BsaXI ACNNNNNCTCC 2 cut(s) 61, 91
Bse1I ACTGG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 49
BsgI GTGCAG 1 cut(s) 12
Bsh1285I CGRYCG 1 cut(s) 20
BsiEI CGRYCG 1 cut(s) 20
BsmI GAATGC 1 cut(s) 58
BsrI ACTGG 1 cut(s) 49
BstC8I GCNNGC 1 cut(s) 97
BstMCI CGRYCG 1 cut(s) 20
Cac8I GCNNGC 1 cut(s) 97
CviAII CATG 1 cut(s) 146
CviJI RGCY 1 cut(s) 152
CviKI_1 RGCY 1 cut(s) 152
FaeI CATG 1 cut(s) 149
FaiI YATR 3 cut(s) 9, 87, 147
FatI CATG 1 cut(s) 145
FspBI CTAG 1 cut(s) 62
Hin1II CATG 1 cut(s) 149
HinfI GANTC 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 42
Hpy188III TCNNGA 2 cut(s) 140, 177
Hpy8I GTNNAC 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 29
Hsp92II CATG 1 cut(s) 149
LpnPI CCDG 4 cut(s) 30, 93, 109, 125
MaeI CTAG 1 cut(s) 62
MboII GAAGA 1 cut(s) 95
MnlI CCTC 1 cut(s) 117
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 1 cut(s) 162
Mva1269I GAATGC 1 cut(s) 58
NlaIII CATG 1 cut(s) 149
PctI GAATGC 1 cut(s) 58
PdmI GAANNNNTTC 1 cut(s) 132
PfeI GAWTC 1 cut(s) 173
SaqAI TTAA 1 cut(s) 162
SetI ASST 1 cut(s) 154
SgeI CNNG 7 cut(s) 27, 57, 74, 92, 108, 152, 158
SspMI CTAG 1 cut(s) 62
TaqI TCGA 1 cut(s) 16
TaqII GACCGA 1 cut(s) 34
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 162
TspGWI ACGGA 1 cut(s) 136
XmnI GAANNNNTTC 1 cut(s) 132
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.