RchiOBHm_Chr1g0328411

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
17817728 .. 17821304
3577 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55784

Sequence Viewer

Length: 183 bp
ATGCCACATAGAACTCGACCTATGACCGCACTTTTGGTGTTTACTGGACTGAATGCTATCTTAGTTTCAACCATTACTCCCGTCTATGATTTCGTCTGCTTTCTTCCTTTTTGGGAAAGAAGGAGGGAACGACTTCGTCAGGAACGTGAAGTCTTTAATAAAGTAGGTTTGGAATCAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.19

Weight (kDa)

10.65

Isoelectric Point (pI)

67.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018339)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G09225
malus_domestica MD00G1018100.v1.1 MD12G1095600.v1.1
prunus_persica Prupe.7G032300_v2.0.a1
pyrus_communis pycom12g08250
rosa_chinensis RchiOBHm_Chr1g0328411 RchiOBHm_Chr1g0328511
rosa_roxburghii Rroxscaffold_4G00321620
rosa_wichuraiana Rw1G007230 Rw1G007260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 27
AgsI TTSAA 1 cut(s) 69
ArsI GACNNNNNNTTYG 2 cut(s) 16, 48
Asp700I GAANNNNTTC 1 cut(s) 132
BsaXI ACNNNNNCTCC 2 cut(s) 61, 91
Bse1I ACTGG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 49
BsmI GAATGC 1 cut(s) 58
BspACI CCGC 1 cut(s) 27
BsrI ACTGG 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 61
DdeI CTNAG 1 cut(s) 61
FaiI YATR 3 cut(s) 9, 23, 87
HinfI GANTC 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 42
Hpy188III TCNNGA 2 cut(s) 140, 177
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 114
HpyCH4IV ACGT 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 61
HpySE526I ACGT 1 cut(s) 145
LpnPI CCDG 2 cut(s) 30, 125
MaeII ACGT 1 cut(s) 145
MboII GAAGA 1 cut(s) 95
MnlI CCTC 1 cut(s) 117
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 1 cut(s) 156
Mva1269I GAATGC 1 cut(s) 58
PcsI WCGNNNNNNNCGW 1 cut(s) 142
PctI GAATGC 1 cut(s) 58
PdmI GAANNNNTTC 1 cut(s) 132
PfeI GAWTC 1 cut(s) 173
PflFI GACNNNGTC 1 cut(s) 135
PsyI GACNNNGTC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 156
SetI ASST 3 cut(s) 22, 148, 169
SgeI CNNG 5 cut(s) 27, 57, 92, 152, 158
SsiI CCGC 1 cut(s) 27
TaiI ACGT 1 cut(s) 148
TaqI TCGA 1 cut(s) 16
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
Tth111I GACNNNGTC 1 cut(s) 135
XmnI GAANNNNTTC 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.