Rw1G007230

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
15230699 .. 15232604
1906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G007230.1

Sequence Viewer

Length: 183 bp
ATGCCACATAGAACTCGACCTATGACTGCACTTTTGGTGTTTACTGGACTGAATGCTATCTTAGTTTCAACCATTACTCCTGTCTATGATTTTGTCTGCTTTCTTCCTTTTTGGGAAAGACGGAGGGAACGACTTCGTCAGGAACGCGAACCTACTTTATTAAAGAGTTCGGAATCAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.16

Weight (kDa)

10.65

Isoelectric Point (pI)

74.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018339)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G09225
malus_domestica MD00G1018100.v1.1 MD12G1095600.v1.1
prunus_persica Prupe.7G032300_v2.0.a1
pyrus_communis pycom12g08250
rosa_chinensis RchiOBHm_Chr1g0328411 RchiOBHm_Chr1g0328511
rosa_roxburghii Rroxscaffold_4G00321620
rosa_wichuraiana Rw1G007230 Rw1G007260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 147
AgsI TTSAA 1 cut(s) 69
ArsI GACNNNNNNTTYG 2 cut(s) 16, 48
Asp700I GAANNNNTTC 1 cut(s) 132
BsaXI ACNNNNNCTCC 2 cut(s) 61, 91
Bse1I ACTGG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 49
BsgI GTGCAG 1 cut(s) 12
Bsh1236I CGCG 1 cut(s) 147
BsmI GAATGC 1 cut(s) 58
BspFNI CGCG 1 cut(s) 147
BsrI ACTGG 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 61
BstFNI CGCG 1 cut(s) 147
BstUI CGCG 1 cut(s) 147
DdeI CTNAG 1 cut(s) 61
FaiI YATR 3 cut(s) 9, 23, 87
HinfI GANTC 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 140, 177
Hpy8I GTNNAC 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 61
LpnPI CCDG 3 cut(s) 30, 93, 125
MboII GAAGA 1 cut(s) 95
MnlI CCTC 1 cut(s) 117
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 1 cut(s) 161
Mva1269I GAATGC 1 cut(s) 58
MvnI CGCG 1 cut(s) 147
PcsI WCGNNNNNNNCGW 1 cut(s) 127
PctI GAATGC 1 cut(s) 58
PdmI GAANNNNTTC 1 cut(s) 132
PfeI GAWTC 1 cut(s) 173
PflFI GACNNNGTC 1 cut(s) 135
PsyI GACNNNGTC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 161
SetI ASST 2 cut(s) 22, 154
SgeI CNNG 5 cut(s) 27, 57, 92, 152, 158
TaqI TCGA 1 cut(s) 16
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TspGWI ACGGA 1 cut(s) 136
Tth111I GACNNNGTC 1 cut(s) 135
XmnI GAANNNNTTC 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.