Rw1G007260

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
15287350 .. 15289440
2091 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G007260.1

Sequence Viewer

Length: 183 bp
ATGCCACATAGAACTCGACCAATGACCGCACTTTTGGTGTTTACTGGACTGAATGCTATCTTAGTTTCAACCATTACTCCCGTCTATGATTTCGTCTGCTTTCTTCCTTTTTGGGAAAGAAGGAGGGAACGACTTTGTCAGGAACGTGAAGCTACTTTATTAAAGAGTTCGGAATCAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.08

Weight (kDa)

9.49

Isoelectric Point (pI)

63.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018339)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G09225
malus_domestica MD00G1018100.v1.1 MD12G1095600.v1.1
prunus_persica Prupe.7G032300_v2.0.a1
pyrus_communis pycom12g08250
rosa_chinensis RchiOBHm_Chr1g0328411 RchiOBHm_Chr1g0328511
rosa_roxburghii Rroxscaffold_4G00321620
rosa_wichuraiana Rw1G007230 Rw1G007260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 27
AgsI TTSAA 1 cut(s) 69
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
ArsI GACNNNNNNTTYG 2 cut(s) 16, 48
BsaXI ACNNNNNCTCC 2 cut(s) 61, 91
Bse1I ACTGG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 49
BsmI GAATGC 1 cut(s) 58
BspACI CCGC 1 cut(s) 27
BsrI ACTGG 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 61
CviJI RGCY 1 cut(s) 152
CviKI_1 RGCY 1 cut(s) 152
DdeI CTNAG 1 cut(s) 61
FaiI YATR 2 cut(s) 9, 87
HinfI GANTC 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 140, 177
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 114
HpyCH4IV ACGT 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 61
HpySE526I ACGT 1 cut(s) 145
LpnPI CCDG 2 cut(s) 30, 125
MaeII ACGT 1 cut(s) 145
MboII GAAGA 1 cut(s) 95
MnlI CCTC 1 cut(s) 117
MseI TTAA 1 cut(s) 161
Mva1269I GAATGC 1 cut(s) 58
PctI GAATGC 1 cut(s) 58
PfeI GAWTC 1 cut(s) 173
PflFI GACNNNGTC 1 cut(s) 135
PsyI GACNNNGTC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 161
SetI ASST 2 cut(s) 148, 154
SgeI CNNG 5 cut(s) 27, 57, 92, 152, 158
SsiI CCGC 1 cut(s) 27
TaiI ACGT 1 cut(s) 148
TaqI TCGA 1 cut(s) 16
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
Tth111I GACNNNGTC 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.