Prupe.8G103000_v2.0.a1

lipid-transfer protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
13420700 .. 13421002
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G103000.1

Sequence Viewer

Length: 303 bp
ATGGCAGCATACAAAAAGCTTGTGGTTATTGTGGCATTGTTTTTGGCACTGGCCATTGGGCCTGAGGCCAATGAGCAGGTCCAGGTAACTTTTTGCCGCATGACAAAAGGGGGTTTGAATGCTTGTGCTCCATCAGTGAGTGGGCTAAACCCTCTTCCTCCCTCAGCTCTGTGTTGCTCGGCTCTTTCCATCGCAGACTTCCAGTGCCTTTGCTTCTTCAAGAACTACTCAAACCTTTTGACTTCCTATGGCATCGACCCCAACCTTGCCATGCAGCTTCCTGCCAAATGCAATCTTCGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

10.66

Weight (kDa)

8.53

Isoelectric Point (pI)

27.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016256)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 67
AciI CCGC 1 cut(s) 97
AcoI YGGCCR 1 cut(s) 51
AgsI TTSAA 2 cut(s) 118, 220
AjnI CCWGG 1 cut(s) 81
AluBI AGCT 3 cut(s) 19, 167, 277
AluI AGCT 3 cut(s) 19, 167, 277
Alw21I GWGCWC 1 cut(s) 130
AoxI GGCC 3 cut(s) 51, 59, 66
ApeKI GCWGC 2 cut(s) 5, 274
AspS9I GGNCC 2 cut(s) 59, 79
AvaII GGWCC 1 cut(s) 79
AxyI CCTNAGG 1 cut(s) 63
BalI TGGCCA 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 130
BbvCI CCTCAGC 1 cut(s) 163
BbvI GCAGC 2 cut(s) 17, 286
BccI CCATC 2 cut(s) 139, 197
BciT130I CCWGG 1 cut(s) 83
BfaI CTAG 1 cut(s) 301
BfuAI ACCTGC 1 cut(s) 67
BisI GCNGC 3 cut(s) 6, 97, 275
BlsI GCNGC 3 cut(s) 7, 98, 276
Bme1390I CCNGG 1 cut(s) 83
Bme18I GGWCC 1 cut(s) 79
BmgT120I GGNCC 2 cut(s) 59, 79
BmrFI CCNGG 1 cut(s) 83
BmsI GCATC 1 cut(s) 261
Bpu10I CCTNAGC 1 cut(s) 163
Bse1I ACTGG 2 cut(s) 54, 202
Bse21I CCTNAGG 1 cut(s) 63
BseBI CCWGG 1 cut(s) 83
BseMII CTCAG 2 cut(s) 54, 177
BseNI ACTGG 2 cut(s) 54, 202
BseXI GCAGC 2 cut(s) 17, 286
BshFI GGCC 3 cut(s) 53, 61, 68
BsiHKAI GWGCWC 1 cut(s) 130
BsmI GAATGC 1 cut(s) 124
BsnI GGCC 3 cut(s) 53, 61, 68
Bsp1286I GDGCHC 1 cut(s) 130
BspACI CCGC 1 cut(s) 97
BspANI GGCC 3 cut(s) 53, 61, 68
BspCNI CTCAG 2 cut(s) 55, 176
BspMI ACCTGC 1 cut(s) 67
BsrI ACTGG 2 cut(s) 54, 202
Bst2UI CCWGG 1 cut(s) 83
Bst6I CTCTTC 1 cut(s) 159
BstDEI CTNAG 2 cut(s) 63, 163
BstMWI GCNNNNNNNGC 1 cut(s) 297
BstNI CCWGG 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 81
BstV1I GCAGC 2 cut(s) 17, 286
Bsu36I CCTNAGG 1 cut(s) 63
BsuRI GGCC 3 cut(s) 53, 61, 68
BtgZI GCGATG 1 cut(s) 175
BtsIMutI CAGTG 3 cut(s) 47, 141, 209
BveI ACCTGC 1 cut(s) 67
Cfr13I GGNCC 2 cut(s) 59, 79
CviAII CATG 2 cut(s) 100, 271
CviJI RGCY 8 cut(s) 19, 53, 61, 68, 145, 167, 182, 277
CviKI_1 RGCY 8 cut(s) 19, 53, 61, 68, 145, 167, 182, 277
DdeI CTNAG 2 cut(s) 63, 163
EaeI YGGCCR 1 cut(s) 51
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 79
Eco81I CCTNAGG 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 81
FaeI CATG 2 cut(s) 103, 274
FaiI YATR 4 cut(s) 10, 101, 249, 272
FatI CATG 2 cut(s) 99, 270
Fnu4HI GCNGC 3 cut(s) 6, 97, 275
Fsp4HI GCNGC 3 cut(s) 6, 97, 275
FspBI CTAG 1 cut(s) 301
GluI GCNGC 3 cut(s) 6, 97, 275
HaeIII GGCC 3 cut(s) 53, 61, 68
Hin1II CATG 2 cut(s) 103, 274
HindIII AAGCTT 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 220
HpyCH4V TGCA 2 cut(s) 274, 291
HpyF10VI GCNNNNNNNGC 1 cut(s) 297
HpyF3I CTNAG 2 cut(s) 63, 163
Hsp92II CATG 2 cut(s) 103, 274
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 7 cut(s) 35, 62, 68, 75, 95, 215, 294
Lsp1109I GCAGC 2 cut(s) 17, 286
LweI GCATC 1 cut(s) 261
MaeI CTAG 1 cut(s) 301
MaeIII GTNAC 1 cut(s) 85
MboII GAAGA 3 cut(s) 146, 208, 287
MhlI GDGCHC 1 cut(s) 130
MlsI TGGCCA 1 cut(s) 53
MluNI TGGCCA 1 cut(s) 53
MnlI CCTC 4 cut(s) 58, 162, 168, 172
Mox20I TGGCCA 1 cut(s) 53
MscI TGGCCA 1 cut(s) 53
Msp20I TGGCCA 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 83
Mva1269I GAATGC 1 cut(s) 124
MvaI CCWGG 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 297
NlaIII CATG 2 cut(s) 103, 274
NmeAIII GCCGAG 1 cut(s) 158
PctI GAATGC 1 cut(s) 124
PkrI GCNGC 3 cut(s) 7, 98, 276
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PspPI GGNCC 2 cut(s) 59, 79
SatI GCNGC 3 cut(s) 6, 97, 275
Sau96I GGNCC 2 cut(s) 59, 79
ScrFI CCNGG 1 cut(s) 83
SduI GDGCHC 1 cut(s) 130
SetI ASST 7 cut(s) 21, 81, 87, 169, 237, 267, 279
SfaNI GCATC 1 cut(s) 261
SinI GGWCC 1 cut(s) 79
SsiI CCGC 1 cut(s) 97
SspMI CTAG 1 cut(s) 301
StyD4I CCNGG 1 cut(s) 81
TaqI TCGA 1 cut(s) 255
TauI GCSGC 1 cut(s) 99
TscAI CASTG 3 cut(s) 54, 141, 209
TseI GCWGC 2 cut(s) 5, 274
TspRI CASTG 3 cut(s) 54, 141, 209
VpaK11BI GGWCC 1 cut(s) 79
XspI CTAG 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.