Prupe.8G144800_v2.0.a1

DNA-directed DNA polymerase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0017237
Physical Location & Seq
Reverse (-)
16096241 .. 16097633
1393 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G144800.1

Sequence Viewer

Length: 654 bp
ATGGAGCTAGCATCAAAATCAATGATTTCAGATTCCAAATTCGCCATACTAAATCCAAGAATCCCAAGCAGTAGAACCCAGATTGCTTCTTCAGTAAAATTTCCCACTACCCTAATCAAGAAAAACACAGAGGCTAGCTCTGGAGCCACAATGCCAACCATGTCTGAGATATTGGCCTCATCAAGAGCCCAAAACCTTGACCTTCAGCTCCAAACTCTAGGACCCTTTTTCAGAATCACTGCCAAGAGCTTGGAGACACAGAAGGAGCTTGGCAAGGCTGAGGGACTGATAAGGTTCTGGCTTAGTGGGAAAATCCTTCACTTGGAGTCAATCAGATTACAGAGAGAGACACTGGGGATGGAGAAGTCAATCTTTGGCATTGGCTTGTTCATTGGAGCTGTTGCCATTCGATACGGCTACGACTGTGGTTGCAGAACAGCTGAGTTGCTTGCGATCAATGACTCTGACATTTTCCACCACAAGCTTGTCAGGTTCTATTCAAGAATCGGATTCAAGGCTGTGCATGAAGTAACTGGTTCGACTTTTGGAGACTATGCCCACATGTTGGTCTGGGGAGGAATTGGGACCCGAATGGATGCCAGTGTTGAAGAACTACTGATCAAATGGTGCACCAGGTTCAAATCTGGAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

218

Amino Acids

24.1

Weight (kDa)

9.3

Isoelectric Point (pI)

34.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017237)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04342
malus_domestica MD05G1100100.v1.1 MD05G1100400.v1.1
prunus_persica Prupe.8G144800_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0253801
rosa_laevigata RLG00000014969
rosa_roxburghii Rroxscaffold_7G00211510
rosa_rugosa Rorug05G0547300
rosa_samantha Rh6AG062900 Rh6BG056200 Rh6CG056300 Rh6DG054100
rosa_wichuraiana Rw6G005600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 565
AcsI RAATTY 2 cut(s) 38, 98
AcuI CTGAAG 2 cut(s) 75, 188
AfiI CCNNNNNNNGG 2 cut(s) 322, 565
AflIII ACRYGT 1 cut(s) 561
AgsI TTSAA 4 cut(s) 501, 514, 608, 640
AjnI CCWGG 1 cut(s) 632
AluBI AGCT 8 cut(s) 7, 138, 208, 249, 268, 398, 440, 484
AluI AGCT 8 cut(s) 7, 138, 208, 249, 268, 398, 440, 484
Alw21I GWGCWC 1 cut(s) 632
Alw26I GTCTC 3 cut(s) 248, 341, 543
Alw44I GTGCAC 1 cut(s) 628
AoxI GGCC 1 cut(s) 174
ApaLI GTGCAC 1 cut(s) 628
ApoI RAATTY 2 cut(s) 38, 98
AspS9I GGNCC 2 cut(s) 221, 585
AsuNHI GCTAGC 2 cut(s) 7, 134
AvaII GGWCC 2 cut(s) 221, 585
BaeGI GKGCMC 1 cut(s) 632
BanII GRGCYC 1 cut(s) 190
Bbv12I GWGCWC 1 cut(s) 632
BbvCI CCTCAGC 1 cut(s) 279
BccI CCATC 1 cut(s) 352
BceAI ACGGC 1 cut(s) 430
BciT130I CCWGG 1 cut(s) 634
BclI TGATCA 1 cut(s) 618
BcoDI GTCTC 3 cut(s) 248, 341, 543
BfaI CTAG 3 cut(s) 8, 135, 218
Bme1390I CCNGG 1 cut(s) 634
Bme18I GGWCC 2 cut(s) 221, 585
BmgT120I GGNCC 2 cut(s) 221, 585
BmiI GGNNCC 4 cut(s) 145, 223, 586, 587
BmrFI CCNGG 1 cut(s) 634
BmrI ACTGGG 1 cut(s) 362
BmsI GCATC 2 cut(s) 20, 586
BmtI GCTAGC 2 cut(s) 11, 138
BmuI ACTGGG 1 cut(s) 362
BplI GAGNNNNNCTC 2 cut(s) 122, 154
BpmI CTGGAG 1 cut(s) 162
Bpu10I CCTNAGC 1 cut(s) 279
Bsc4I CCNNNNNNNGG 2 cut(s) 322, 565
Bse1I ACTGG 3 cut(s) 357, 538, 600
BseBI CCWGG 1 cut(s) 634
BseGI GGATG 2 cut(s) 363, 601
BseLI CCNNNNNNNGG 2 cut(s) 322, 565
BseMII CTCAG 3 cut(s) 156, 270, 432
BseNI ACTGG 3 cut(s) 357, 538, 600
BseSI GKGCMC 1 cut(s) 632
BshFI GGCC 1 cut(s) 176
BsiHKAI GWGCWC 1 cut(s) 632
BslFI GGGAC 2 cut(s) 297, 598
BslI CCNNNNNNNGG 2 cut(s) 322, 565
BsmAI GTCTC 3 cut(s) 248, 341, 543
BsmFI GGGAC 2 cut(s) 297, 598
BsnI GGCC 1 cut(s) 176
Bsp1286I GDGCHC 2 cut(s) 190, 632
Bsp143I GATC 2 cut(s) 453, 618
BspANI GGCC 1 cut(s) 176
BspCNI CTCAG 3 cut(s) 157, 271, 433
BspLI GGNNCC 4 cut(s) 145, 223, 586, 587
BspOI GCTAGC 2 cut(s) 11, 138
BsrI ACTGG 3 cut(s) 357, 538, 600
BssMI GATC 2 cut(s) 453, 618
Bst2UI CCWGG 1 cut(s) 634
Bst4CI ACNGT 1 cut(s) 425
BstC8I GCNNGC 3 cut(s) 9, 136, 450
BstDEI CTNAG 4 cut(s) 165, 279, 302, 441
BstF5I GGATG 2 cut(s) 363, 601
BstKTI GATC 2 cut(s) 456, 621
BstMAI GTCTC 3 cut(s) 248, 341, 543
BstMBI GATC 2 cut(s) 453, 618
BstNI CCWGG 1 cut(s) 634
BstNSI RCATGY 1 cut(s) 565
BstSCI CCNGG 1 cut(s) 632
BstSLI GKGCMC 1 cut(s) 632
BstXI CCANNNNNNTGG 1 cut(s) 250
BsuRI GGCC 1 cut(s) 176
BtsCI GGATG 2 cut(s) 363, 601
BtsI GCAGTG 1 cut(s) 237
BtsIMutI CAGTG 3 cut(s) 237, 350, 607
Cac8I GCNNGC 3 cut(s) 9, 136, 450
Cfr13I GGNCC 2 cut(s) 221, 585
CsiI ACCWGGT 1 cut(s) 632
CviAII CATG 3 cut(s) 160, 524, 562
DdeI CTNAG 4 cut(s) 165, 279, 302, 441
DpnI GATC 2 cut(s) 455, 620
DpnII GATC 2 cut(s) 453, 618
Eco24I GRGCYC 1 cut(s) 190
Eco47I GGWCC 2 cut(s) 221, 585
Eco57I CTGAAG 2 cut(s) 75, 188
EcoO109I RGGNCCY 2 cut(s) 221, 585
EcoRII CCWGG 1 cut(s) 632
EcoT38I GRGCYC 1 cut(s) 190
FaeI CATG 3 cut(s) 163, 527, 565
FaiI YATR 5 cut(s) 47, 161, 525, 555, 563
FalI AAGNNNNNCTT 2 cut(s) 356, 388
FaqI GGGAC 2 cut(s) 297, 598
FatI CATG 3 cut(s) 159, 523, 561
FbaI TGATCA 1 cut(s) 618
FokI GGATG 2 cut(s) 370, 608
FriOI GRGCYC 1 cut(s) 190
FspBI CTAG 3 cut(s) 8, 135, 218
GsuI CTGGAG 1 cut(s) 162
HaeIII GGCC 1 cut(s) 176
Hin1II CATG 3 cut(s) 163, 527, 565
HindIII AAGCTT 1 cut(s) 482
HinfI GANTC 7 cut(s) 32, 60, 234, 326, 461, 504, 510
Hpy166II GTNNAC 1 cut(s) 630
Hpy188I TCNGA 6 cut(s) 31, 166, 233, 335, 466, 509
Hpy188III TCNNGA 5 cut(s) 118, 141, 183, 501, 645
Hpy8I GTNNAC 1 cut(s) 630
HpyAV CCTTC 3 cut(s) 212, 256, 326
HpyCH4III ACNGT 1 cut(s) 425
HpyCH4V TGCA 3 cut(s) 432, 523, 630
HpyF3I CTNAG 4 cut(s) 165, 279, 302, 441
Hsp92II CATG 3 cut(s) 163, 527, 565
KflI GGGWCCC 1 cut(s) 585
Ksp22I TGATCA 1 cut(s) 618
Kzo9I GATC 2 cut(s) 453, 618
LmnI GCTCC 5 cut(s) 4, 143, 213, 265, 395
LweI GCATC 2 cut(s) 20, 586
MabI ACCWGGT 1 cut(s) 632
MaeI CTAG 3 cut(s) 8, 135, 218
MaeIII GTNAC 1 cut(s) 529
MalI GATC 2 cut(s) 455, 620
MboI GATC 2 cut(s) 453, 618
MboII GAAGA 2 cut(s) 81, 620
MhlI GDGCHC 2 cut(s) 190, 632
MluCI AATT 3 cut(s) 38, 98, 579
MlyI GAGTC 2 cut(s) 335, 455
MnlI CCTC 4 cut(s) 124, 187, 274, 569
MspA1I CMGCKG 1 cut(s) 440
MspR9I CCNGG 1 cut(s) 634
MvaI CCWGG 1 cut(s) 634
NdeII GATC 2 cut(s) 453, 618
NheI GCTAGC 2 cut(s) 7, 134
NlaIII CATG 3 cut(s) 163, 527, 565
NlaIV GGNNCC 4 cut(s) 145, 223, 586, 587
NspI RCATGY 1 cut(s) 565
PciI ACATGT 1 cut(s) 561
PfeI GAWTC 5 cut(s) 32, 60, 234, 504, 510
PflMI CCANNNNNTGG 1 cut(s) 565
PleI GAGTC 2 cut(s) 334, 455
PpsI GAGTC 2 cut(s) 334, 455
PpuMI RGGWCCY 2 cut(s) 221, 585
PscI ACATGT 1 cut(s) 561
Psp5II RGGWCCY 2 cut(s) 221, 585
Psp6I CCWGG 1 cut(s) 632
PspGI CCWGG 1 cut(s) 632
PspN4I GGNNCC 4 cut(s) 145, 223, 586, 587
PspPI GGNCC 2 cut(s) 221, 585
PspPPI RGGWCCY 2 cut(s) 221, 585
PvuII CAGCTG 1 cut(s) 440
Sau3AI GATC 2 cut(s) 453, 618
Sau96I GGNCC 2 cut(s) 221, 585
SchI GAGTC 2 cut(s) 335, 455
ScrFI CCNGG 1 cut(s) 634
SduI GDGCHC 2 cut(s) 190, 632
SexAI ACCWGGT 1 cut(s) 632
SfaNI GCATC 2 cut(s) 20, 586
SinI GGWCC 2 cut(s) 221, 585
Sse9I AATT 3 cut(s) 38, 98, 579
SspMI CTAG 3 cut(s) 8, 135, 218
StyD4I CCNGG 1 cut(s) 632
TaaI ACNGT 1 cut(s) 425
TaqI TCGA 2 cut(s) 409, 539
TasI AATT 3 cut(s) 38, 98, 579
TfiI GAWTC 5 cut(s) 32, 60, 234, 504, 510
TscAI CASTG 3 cut(s) 244, 357, 607
TspDTI ATGAA 2 cut(s) 379, 540
TspRI CASTG 3 cut(s) 244, 357, 607
Van91I CCANNNNNTGG 1 cut(s) 565
VneI GTGCAC 1 cut(s) 628
VpaK11BI GGWCC 2 cut(s) 221, 585
XapI RAATTY 2 cut(s) 38, 98
XceI RCATGY 1 cut(s) 565
XspI CTAG 3 cut(s) 8, 135, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.