pycom01g03900

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
2937764 .. 2938077
314 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g03900.1

Sequence Viewer

Length: 225 bp
ATGACAATAAGTGGGAGGAAATCTGTCTTGTTCTTGGCTGCATCAGTTTTGGCTGTTAGTTTTATGGGATTTATTGCTTTCAATGCTTTCTTGTCAGTTACAAACTGCTCAGCCTCCTGGGAACCTTTCAGTGTTAGAACGGCCCTAACTTCTTCTAGAACAATGATATTAACAATCTGCGAAATGCTCCAGAAAATAGACATCCGTAGCTTTCCAAGAATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.18

Weight (kDa)

10.08

Isoelectric Point (pI)

29.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 82
AjnI CCWGG 1 cut(s) 116
AluBI AGCT 1 cut(s) 210
AluI AGCT 1 cut(s) 210
AoxI GGCC 1 cut(s) 141
ApeKI GCWGC 1 cut(s) 38
AspS9I GGNCC 1 cut(s) 142
BbvI GCAGC 1 cut(s) 25
BceAI ACGGC 1 cut(s) 156
BciT130I CCWGG 1 cut(s) 118
BfaI CTAG 1 cut(s) 156
BisI GCNGC 1 cut(s) 39
BlpI GCTNAGC 1 cut(s) 109
BlsI GCNGC 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 118
BmgT120I GGNCC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 118
BmsI GCATC 1 cut(s) 50
BpmI CTGGAG 1 cut(s) 173
Bpu1102I GCTNAGC 1 cut(s) 109
BsaJI CCNNGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 123
BseXI GCAGC 1 cut(s) 25
BshFI GGCC 1 cut(s) 143
BsnI GGCC 1 cut(s) 143
Bsp1720I GCTNAGC 1 cut(s) 109
BspANI GGCC 1 cut(s) 143
BspCNI CTCAG 1 cut(s) 122
BspLI GGNNCC 1 cut(s) 123
BssECI CCNNGG 1 cut(s) 117
Bst2UI CCWGG 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 109
BstF5I GGATG 1 cut(s) 201
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 116
BstV1I GCAGC 1 cut(s) 25
BsuRI GGCC 1 cut(s) 143
BtsCI GGATG 1 cut(s) 201
BtsIMutI CAGTG 1 cut(s) 136
Cfr13I GGNCC 1 cut(s) 142
CviJI RGCY 5 cut(s) 38, 53, 113, 143, 210
CviKI_1 RGCY 5 cut(s) 38, 53, 113, 143, 210
DdeI CTNAG 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 116
FaiI YATR 2 cut(s) 65, 223
Fnu4HI GCNGC 1 cut(s) 39
FokI GGATG 1 cut(s) 188
Fsp4HI GCNGC 1 cut(s) 39
FspBI CTAG 1 cut(s) 156
GluI GCNGC 1 cut(s) 39
GsuI CTGGAG 1 cut(s) 173
HaeIII GGCC 1 cut(s) 143
Hpy188III TCNNGA 2 cut(s) 156, 190
HpyCH4V TGCA 1 cut(s) 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 109
LmnI GCTCC 1 cut(s) 192
LpnPI CCDG 3 cut(s) 103, 130, 203
Lsp1109I GCAGC 1 cut(s) 25
LweI GCATC 1 cut(s) 50
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 97
MboII GAAGA 1 cut(s) 144
MnlI CCTC 2 cut(s) 9, 124
MseI TTAA 1 cut(s) 170
MspR9I CCNGG 1 cut(s) 118
MvaI CCWGG 1 cut(s) 118
MwoI GCNNNNNNNGC 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 123
PkrI GCNGC 1 cut(s) 40
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 123
PspPI GGNCC 1 cut(s) 142
SaqAI TTAA 1 cut(s) 170
SatI GCNGC 1 cut(s) 39
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 118
SetI ASST 2 cut(s) 127, 212
SfaNI GCATC 1 cut(s) 50
SgeI CNNG 7 cut(s) 40, 46, 103, 129, 130, 168, 202
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 116
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TscAI CASTG 1 cut(s) 136
TseI GCWGC 1 cut(s) 38
TspGWI ACGGA 1 cut(s) 194
TspRI CASTG 1 cut(s) 136
XbaI TCTAGA 1 cut(s) 155
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.