pycom04g05930

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
5811975 .. 5812268
294 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g05930.1

Sequence Viewer

Length: 294 bp
ATGGGGTTGACGGAGGCACAAGAGAGGGAGGCTTGTGTGGATTCATTATTGCCATCACCATCTCAAACAACCAAGTATTCATGGGAGTTCTCGAGATCTGTCGAAAACAACGTGATTTGGGTTTCCAAGTCTGATAAGATTCTTCTAGATCTCTGGAAACCAGTTGTCAAGTACGAGTTTTCTCATCTCGTGACGACTTCAGGTCGTAAATTTCAATTCTCACCGGAATTCGGTGGGGCGCTTCTAGCGCAGTGGGAGAGACGAAAAAGGGACATACCTTTTATTCTGAGGTGA

Protein Analysis

98

Amino Acids

11.31

Weight (kDa)

8.85

Isoelectric Point (pI)

58.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 209, 227
AcuI CTGAAG 1 cut(s) 183
AfaI GTAC 1 cut(s) 173
AfiI CCNNNNNNNGG 1 cut(s) 230
AgsI TTSAA 1 cut(s) 215
AhdI GACNNNNNGTC 1 cut(s) 201
Alw26I GTCTC 1 cut(s) 253
Ama87I CYCGRG 1 cut(s) 91
ApoI RAATTY 2 cut(s) 209, 227
AspLEI GCGC 2 cut(s) 241, 250
AsuHPI GGTGA 2 cut(s) 48, 213
AvaI CYCGRG 1 cut(s) 91
BauI CACGAG 1 cut(s) 188
BccI CCATC 2 cut(s) 61, 67
BcoDI GTCTC 1 cut(s) 253
BfaI CTAG 2 cut(s) 146, 245
BfoI RGCGCY 1 cut(s) 242
BglII AGATCT 2 cut(s) 95, 148
BmeRI GACNNNNNGTC 1 cut(s) 201
BmeT110I CYCGRG 1 cut(s) 91
BsaWI WCCGGW 1 cut(s) 223
Bsc4I CCNNNNNNNGG 1 cut(s) 230
Bse1I ACTGG 1 cut(s) 161
BseLI CCNNNNNNNGG 1 cut(s) 230
BseMII CTCAG 1 cut(s) 278
BseNI ACTGG 1 cut(s) 161
BsiHKCI CYCGRG 1 cut(s) 91
BsiSI CCGG 1 cut(s) 224
BslFI GGGAC 1 cut(s) 284
BslI CCNNNNNNNGG 1 cut(s) 230
BsmAI GTCTC 1 cut(s) 253
BsmBI CGTCTC 1 cut(s) 253
BsmFI GGGAC 1 cut(s) 284
BsoBI CYCGRG 1 cut(s) 91
Bsp143I GATC 2 cut(s) 95, 148
BspCNI CTCAG 1 cut(s) 279
BsrI ACTGG 1 cut(s) 161
BssMI GATC 2 cut(s) 95, 148
BssSI CACGAG 1 cut(s) 188
Bst2BI CACGAG 1 cut(s) 188
BstDEI CTNAG 1 cut(s) 287
BstH2I RGCGCY 1 cut(s) 242
BstHHI GCGC 2 cut(s) 241, 250
BstKTI GATC 2 cut(s) 98, 151
BstMAI GTCTC 1 cut(s) 253
BstMBI GATC 2 cut(s) 95, 148
BstMWI GCNNNNNNNGC 2 cut(s) 245, 247
BstX2I RGATCY 2 cut(s) 95, 148
BstYI RGATCY 2 cut(s) 95, 148
BtsI GCAGTG 1 cut(s) 257
BtsIMutI CAGTG 1 cut(s) 257
CfoI GCGC 2 cut(s) 241, 250
Csp6I GTAC 1 cut(s) 172
CviAII CATG 1 cut(s) 81
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
CviQI GTAC 1 cut(s) 172
DdeI CTNAG 1 cut(s) 287
DpnI GATC 2 cut(s) 97, 150
DpnII GATC 2 cut(s) 95, 148
DriI GACNNNNNGTC 1 cut(s) 201
Eam1105I GACNNNNNGTC 1 cut(s) 201
Eco57I CTGAAG 1 cut(s) 183
Eco88I CYCGRG 1 cut(s) 91
EcoRI GAATTC 1 cut(s) 227
Esp3I CGTCTC 1 cut(s) 253
FaeI CATG 1 cut(s) 84
FaiI YATR 2 cut(s) 82, 275
FaqI GGGAC 1 cut(s) 284
FatI CATG 1 cut(s) 80
FspBI CTAG 2 cut(s) 146, 245
GlaI GCGC 2 cut(s) 240, 249
HaeII RGCGCY 1 cut(s) 242
HapII CCGG 1 cut(s) 224
HhaI GCGC 2 cut(s) 241, 250
Hin1II CATG 1 cut(s) 84
Hin6I GCGC 2 cut(s) 239, 248
HinP1I GCGC 2 cut(s) 239, 248
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HinfI GANTC 2 cut(s) 41, 139
HpaII CCGG 1 cut(s) 224
HphI GGTGA 2 cut(s) 48, 213
Hpy166II GTNNAC 1 cut(s) 9
Hpy188I TCNGA 2 cut(s) 133, 288
Hpy188III TCNNGA 5 cut(s) 91, 93, 146, 154, 190
Hpy8I GTNNAC 1 cut(s) 9
HpyCH4IV ACGT 1 cut(s) 111
HpyF10VI GCNNNNNNNGC 2 cut(s) 245, 247
HpyF3I CTNAG 1 cut(s) 287
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 1 cut(s) 84
HspAI GCGC 2 cut(s) 239, 248
Kzo9I GATC 2 cut(s) 95, 148
LpnPI CCDG 4 cut(s) 139, 174, 186, 237
MaeI CTAG 2 cut(s) 146, 245
MaeII ACGT 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 190
MalI GATC 2 cut(s) 97, 150
MboI GATC 2 cut(s) 95, 148
MboII GAAGA 1 cut(s) 134
MflI RGATCY 2 cut(s) 95, 148
MluCI AATT 3 cut(s) 209, 215, 227
MnlI CCTC 4 cut(s) 7, 18, 22, 282
MspI CCGG 1 cut(s) 224
MwoI GCNNNNNNNGC 2 cut(s) 245, 247
NdeII GATC 2 cut(s) 95, 148
NlaIII CATG 1 cut(s) 84
NmuCI GTSAC 1 cut(s) 190
PaeR7I CTCGAG 1 cut(s) 91
PcsI WCGNNNNNNNCGW 1 cut(s) 108
PfeI GAWTC 2 cut(s) 41, 139
PsuI RGATCY 2 cut(s) 95, 148
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
Sau3AI GATC 2 cut(s) 95, 148
SetI ASST 4 cut(s) 114, 205, 280, 293
Sfr274I CTCGAG 1 cut(s) 91
SlaI CTCGAG 1 cut(s) 91
SmlI CTYRAG 1 cut(s) 91
SmoI CTYRAG 1 cut(s) 91
Sse9I AATT 3 cut(s) 209, 215, 227
SspMI CTAG 2 cut(s) 146, 245
TaiI ACGT 1 cut(s) 114
TaqI TCGA 2 cut(s) 92, 102
TasI AATT 3 cut(s) 209, 215, 227
TfiI GAWTC 2 cut(s) 41, 139
TscAI CASTG 1 cut(s) 257
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 2 cut(s) 33, 69
TspGWI ACGGA 1 cut(s) 26
TspRI CASTG 1 cut(s) 257
XapI RAATTY 2 cut(s) 209, 227
XbaI TCTAGA 1 cut(s) 145
XhoI CTCGAG 1 cut(s) 91
XspI CTAG 2 cut(s) 146, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.