pycom06g19110

Cytochrome p450

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
22611379 .. 22611657
279 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g19110.1

Sequence Viewer

Length: 279 bp
ATGATTTCGGGTGCCCTAGACATGTCAGCGACTGCGATTGTTTGGATTCTAGCCGAACTCTTGAGGCATCCTAGGGCTATGAAGTTTCTCCAACGAGAGTTCCAAACCGTAATAGGAATGGATCGAACGGTGGAGGAGAGCGATTTGCCAAATTTGGACTACTTGAACAAGGTTGTCAAAGAGAGCGTTAGGTTTCATCTGGTTGCACCATTGCTGATTCCACATGCATCCATGAAGGACGTCACAGTTGGCCAAGATGTATTGTCAAAACGCTTTTAA

Protein Analysis

93

Amino Acids

10.45

Weight (kDa)

6.83

Isoelectric Point (pI)

37.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 2 - 85 2e-21 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019271)

Species Orthologous Gene IDs
malus_domestica MD06G1214500.v1.1
pyrus_communis pycom06g19110
rosa_chinensis RchiOBHm_Chr1g0359891 RchiOBHm_Chr1g0359921
rosa_multiflora Rmu_sc0035715.1_g000001 Rmu_sc0038988.1_g000002
rosa_roxburghii Rroxscaffold_1G00061990
rosa_samantha Rh1AG287700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 243
AccB1I GGYRCC 1 cut(s) 11
AclWI GGATC 1 cut(s) 129
AcoI YGGCCR 1 cut(s) 250
AcsI RAATTY 1 cut(s) 151
AcyI GRCGYC 1 cut(s) 240
AflIII ACRYGT 1 cut(s) 21
AgsI TTSAA 1 cut(s) 166
AlwI GGATC 1 cut(s) 129
AlwNI CAGNNNCTG 1 cut(s) 32
AoxI GGCC 1 cut(s) 250
ApoI RAATTY 1 cut(s) 151
AspA2I CCTAGG 1 cut(s) 71
AvrII CCTAGG 1 cut(s) 71
BaeGI GKGCMC 1 cut(s) 16
BalI TGGCCA 1 cut(s) 252
BanI GGYRCC 1 cut(s) 11
BfaI CTAG 3 cut(s) 17, 50, 72
BlnI CCTAGG 1 cut(s) 71
BmiI GGNNCC 1 cut(s) 13
BmsI GCATC 2 cut(s) 76, 236
BpuEI CTTGAG 1 cut(s) 82
BsaHI GRCGYC 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 71
Bse3DI GCAATG 1 cut(s) 209
BseDI CCNNGG 1 cut(s) 71
BseGI GGATG 2 cut(s) 67, 227
BseMI GCAATG 1 cut(s) 209
BseRI GAGGAG 1 cut(s) 149
BseSI GKGCMC 1 cut(s) 16
BshFI GGCC 1 cut(s) 252
BshNI GGYRCC 1 cut(s) 11
BsnI GGCC 1 cut(s) 252
Bsp1286I GDGCHC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 121
BspANI GGCC 1 cut(s) 252
BspLI GGNNCC 1 cut(s) 13
BspPI GGATC 1 cut(s) 129
BspT107I GGYRCC 1 cut(s) 11
BsrDI GCAATG 1 cut(s) 209
BssECI CCNNGG 1 cut(s) 71
BssMI GATC 1 cut(s) 121
BssNI GRCGYC 1 cut(s) 240
BssT1I CCWWGG 1 cut(s) 71
Bst4CI ACNGT 3 cut(s) 109, 130, 247
BstACI GRCGYC 1 cut(s) 240
BstF5I GGATG 2 cut(s) 67, 227
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstNSI RCATGY 2 cut(s) 25, 227
BstSLI GKGCMC 1 cut(s) 16
BsuRI GGCC 1 cut(s) 252
BtsCI GGATG 2 cut(s) 67, 227
CaiI CAGNNNCTG 1 cut(s) 32
CviAII CATG 3 cut(s) 22, 224, 232
CviJI RGCY 3 cut(s) 53, 77, 252
CviKI_1 RGCY 3 cut(s) 53, 77, 252
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
EaeI YGGCCR 1 cut(s) 250
Eco130I CCWWGG 1 cut(s) 71
EcoT14I CCWWGG 1 cut(s) 71
EcoT22I ATGCAT 1 cut(s) 229
ErhI CCWWGG 1 cut(s) 71
FaeI CATG 3 cut(s) 25, 227, 235
FaiI YATR 4 cut(s) 23, 80, 225, 233
FatI CATG 3 cut(s) 21, 223, 231
FokI GGATG 2 cut(s) 54, 214
FspBI CTAG 3 cut(s) 17, 50, 72
HaeIII GGCC 1 cut(s) 252
Hin1I GRCGYC 1 cut(s) 240
Hin1II CATG 3 cut(s) 25, 227, 235
HinfI GANTC 2 cut(s) 46, 217
Hpy188III TCNNGA 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 229
HpyCH4III ACNGT 3 cut(s) 109, 130, 247
HpyCH4IV ACGT 1 cut(s) 240
HpyCH4V TGCA 2 cut(s) 206, 227
HpySE526I ACGT 1 cut(s) 240
Hsp92I GRCGYC 1 cut(s) 240
Hsp92II CATG 3 cut(s) 25, 227, 235
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 1 cut(s) 185
LweI GCATC 2 cut(s) 76, 236
MaeI CTAG 3 cut(s) 17, 50, 72
MaeII ACGT 1 cut(s) 240
MaeIII GTNAC 1 cut(s) 241
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MhlI GDGCHC 1 cut(s) 16
MlsI TGGCCA 1 cut(s) 252
MluCI AATT 1 cut(s) 151
MluNI TGGCCA 1 cut(s) 252
MmeI TCCRAC 1 cut(s) 115
MnlI CCTC 2 cut(s) 57, 127
Mox20I TGGCCA 1 cut(s) 252
Mph1103I ATGCAT 1 cut(s) 229
MscI TGGCCA 1 cut(s) 252
MseI TTAA 1 cut(s) 277
Msp20I TGGCCA 1 cut(s) 252
NdeII GATC 1 cut(s) 121
NlaIII CATG 3 cut(s) 25, 227, 235
NlaIV GGNNCC 1 cut(s) 13
NmuCI GTSAC 1 cut(s) 241
NsiI ATGCAT 1 cut(s) 229
NspI RCATGY 2 cut(s) 25, 227
PciI ACATGT 1 cut(s) 21
PfeI GAWTC 2 cut(s) 46, 217
PscI ACATGT 1 cut(s) 21
PspN4I GGNNCC 1 cut(s) 13
PstNI CAGNNNCTG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 277
Sau3AI GATC 1 cut(s) 121
SduI GDGCHC 1 cut(s) 16
SetI ASST 3 cut(s) 174, 194, 243
SfaNI GCATC 2 cut(s) 76, 236
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 1 cut(s) 151
SspMI CTAG 3 cut(s) 17, 50, 72
StyI CCWWGG 1 cut(s) 71
TaaI ACNGT 3 cut(s) 109, 130, 247
TaiI ACGT 1 cut(s) 243
TaqI TCGA 1 cut(s) 124
TasI AATT 1 cut(s) 151
TfiI GAWTC 2 cut(s) 46, 217
Tru1I TTAA 1 cut(s) 277
Tru9I TTAA 1 cut(s) 277
TseFI GTSAC 1 cut(s) 241
Tsp45I GTSAC 1 cut(s) 241
TspDTI ATGAA 3 cut(s) 95, 185, 248
XapI RAATTY 1 cut(s) 151
XceI RCATGY 2 cut(s) 25, 227
XmaJI CCTAGG 1 cut(s) 71
XspI CTAG 3 cut(s) 17, 50, 72
ZraI GACGTC 1 cut(s) 241
Zsp2I ATGCAT 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.