pycom07g14980

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
17035496 .. 17035705
210 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g14980.1

Sequence Viewer

Length: 210 bp
ATGGCTGGCCTTCAATACAACTTCTTTCCCACTGACTTCCTCTACCCTCGTGCTGCTCCTAAGTTGAGGACCTTAGAAAAAGCTACTGATCTTCCCCTGCAAACCACCAAAGCAGATCATGCAGCCAGCGACCTTGAACAGCTCAAGATTCAACACCGTGGAGTTCAAGTAGTCAAGATTGCAAAATATCCTCCTGTAATGCATGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.78

Weight (kDa)

9.45

Isoelectric Point (pI)

36.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018460)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 14, 137, 152, 167
AluBI AGCT 2 cut(s) 83, 142
AluI AGCT 2 cut(s) 83, 142
AoxI GGCC 1 cut(s) 7
ApeKI GCWGC 2 cut(s) 53, 122
AspS9I GGNCC 1 cut(s) 69
AvaII GGWCC 1 cut(s) 69
BauI CACGAG 1 cut(s) 48
BbvI GCAGC 2 cut(s) 40, 134
BisI GCNGC 2 cut(s) 54, 123
BlsI GCNGC 2 cut(s) 55, 124
Bme18I GGWCC 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 69
BpuEI CTTGAG 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 157
BsaXI ACNNNNNCTCC 2 cut(s) 153, 183
BseDI CCNNGG 1 cut(s) 157
BseXI GCAGC 2 cut(s) 40, 134
BshFI GGCC 1 cut(s) 9
BsnI GGCC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 88, 115
BspANI GGCC 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 157
BssMI GATC 2 cut(s) 88, 115
BssSI CACGAG 1 cut(s) 48
Bst2BI CACGAG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 158
BstAPI GCANNNNNTGC 1 cut(s) 119
BstC8I GCNNGC 2 cut(s) 7, 127
BstDEI CTNAG 2 cut(s) 60, 73
BstDSI CCRYGG 1 cut(s) 157
BstKTI GATC 2 cut(s) 91, 118
BstMBI GATC 2 cut(s) 88, 115
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstV1I GCAGC 2 cut(s) 40, 134
BsuRI GGCC 1 cut(s) 9
BtgI CCRYGG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 30
Cac8I GCNNGC 2 cut(s) 7, 127
Cfr13I GGNCC 1 cut(s) 69
CviAII CATG 2 cut(s) 119, 203
CviJI RGCY 5 cut(s) 5, 9, 83, 125, 142
CviKI_1 RGCY 5 cut(s) 5, 9, 83, 125, 142
DdeI CTNAG 2 cut(s) 60, 73
DpnI GATC 2 cut(s) 90, 117
DpnII GATC 2 cut(s) 88, 115
Eco47I GGWCC 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 69
EcoT22I ATGCAT 1 cut(s) 204
FaeI CATG 2 cut(s) 122, 206
FaiI YATR 2 cut(s) 120, 204
FatI CATG 2 cut(s) 118, 202
Fnu4HI GCNGC 2 cut(s) 54, 123
Fsp4HI GCNGC 2 cut(s) 54, 123
GluI GCNGC 2 cut(s) 54, 123
HaeIII GGCC 1 cut(s) 9
Hin1II CATG 2 cut(s) 122, 206
HinfI GANTC 1 cut(s) 148
Hpy188III TCNNGA 2 cut(s) 145, 175
HpyAV CCTTC 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4V TGCA 4 cut(s) 100, 122, 182, 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 2 cut(s) 60, 73
Hsp92II CATG 2 cut(s) 122, 206
Kzo9I GATC 2 cut(s) 88, 115
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 2 cut(s) 110, 139
Lsp1109I GCAGC 2 cut(s) 40, 134
MalI GATC 2 cut(s) 90, 117
MboI GATC 2 cut(s) 88, 115
MboII GAAGA 1 cut(s) 83
MnlI CCTC 4 cut(s) 50, 57, 60, 201
Mph1103I ATGCAT 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 119
NdeII GATC 2 cut(s) 88, 115
NlaIII CATG 2 cut(s) 122, 206
NsiI ATGCAT 1 cut(s) 204
PfeI GAWTC 1 cut(s) 148
PkrI GCNGC 2 cut(s) 55, 124
PpuMI RGGWCCY 1 cut(s) 69
Psp5II RGGWCCY 1 cut(s) 69
PspPI GGNCC 1 cut(s) 69
PspPPI RGGWCCY 1 cut(s) 69
SatI GCNGC 2 cut(s) 54, 123
Sau3AI GATC 2 cut(s) 88, 115
Sau96I GGNCC 1 cut(s) 69
SetI ASST 4 cut(s) 74, 85, 135, 144
SinI GGWCC 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
TaaI ACNGT 1 cut(s) 158
TfiI GAWTC 1 cut(s) 148
TscAI CASTG 1 cut(s) 37
TseI GCWGC 2 cut(s) 53, 122
TspRI CASTG 1 cut(s) 37
VpaK11BI GGWCC 1 cut(s) 69
Zsp2I ATGCAT 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.