Rh2AG310800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
39611605 .. 39611907
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG310800.1

Sequence Viewer

Length: 303 bp
ATGGCTGGCCTTCAGTACAACTTCTTCCCTACCGATTTTTTTTACCCTCGTACAAAGCCGAAGGTGTTGGATAGCGCTCGAAAAGAAGTATTTCAGCTTCCAATTACTACTAACAGAGATGTAGTTCACAGTCTAGAACAGCCTACAAGCCTTGTTCTTAACAATCTCAACGAAAGCCAGGTACTGAAACCATGCATAGGCGAAAACAAAGTACGTGCCTCTGTAGTTATTAACAAACCATGGCAAACAACTAAAGAGGATTCAGAGACTACTGAAAGTGATGAGAAATTGCCCTGTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.37

Weight (kDa)

5.79

Isoelectric Point (pI)

34.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018460)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 4 cut(s) 17, 52, 183, 213
AfeI AGCGCT 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 197
AjnI CCWGG 1 cut(s) 177
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 260
AlwNI CAGNNNCTG 1 cut(s) 184
Aor51HI AGCGCT 1 cut(s) 76
AoxI GGCC 1 cut(s) 7
Asp700I GAANNNNTTC 1 cut(s) 90
AspLEI GCGC 1 cut(s) 77
BarI GAAGNNNNNNTAC 4 cut(s) 8, 40, 81, 113
BciT130I CCWGG 1 cut(s) 179
BcoDI GTCTC 1 cut(s) 260
BfaI CTAG 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 222
BfoI RGCGCY 1 cut(s) 78
Bme1390I CCNGG 1 cut(s) 179
BmrFI CCNGG 1 cut(s) 179
BsaAI YACGTR 1 cut(s) 215
BsaJI CCNNGG 1 cut(s) 239
Bsc4I CCNNNNNNNGG 1 cut(s) 197
BseBI CCWGG 1 cut(s) 179
BseDI CCNNGG 1 cut(s) 239
BseLI CCNNNNNNNGG 1 cut(s) 197
BshFI GGCC 1 cut(s) 9
BslI CCNNNNNNNGG 1 cut(s) 197
BsmAI GTCTC 1 cut(s) 260
BsnI GGCC 1 cut(s) 9
Bsp19I CCATGG 1 cut(s) 239
BspANI GGCC 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 239
BssT1I CCWWGG 1 cut(s) 239
Bst2UI CCWGG 1 cut(s) 179
Bst4CI ACNGT 1 cut(s) 131
BstBAI YACGTR 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 7
BstDSI CCRYGG 1 cut(s) 239
BstH2I RGCGCY 1 cut(s) 78
BstHHI GCGC 1 cut(s) 77
BstMAI GTCTC 1 cut(s) 260
BstNI CCWGG 1 cut(s) 179
BstSCI CCNGG 1 cut(s) 177
BstSFI CTRYAG 1 cut(s) 222
BsuRI GGCC 1 cut(s) 9
BtgI CCRYGG 1 cut(s) 239
Cac8I GCNNGC 1 cut(s) 7
CaiI CAGNNNCTG 1 cut(s) 184
CfoI GCGC 1 cut(s) 77
Csp6I GTAC 4 cut(s) 16, 51, 182, 212
CviAII CATG 2 cut(s) 192, 240
CviJI RGCY 7 cut(s) 5, 9, 58, 97, 142, 150, 177
CviKI_1 RGCY 7 cut(s) 5, 9, 58, 97, 142, 150, 177
CviQI GTAC 4 cut(s) 16, 51, 182, 212
Eco130I CCWWGG 1 cut(s) 239
Eco47III AGCGCT 1 cut(s) 76
EcoRII CCWGG 1 cut(s) 177
EcoT14I CCWWGG 1 cut(s) 239
EcoT22I ATGCAT 1 cut(s) 197
ErhI CCWWGG 1 cut(s) 239
FaeI CATG 2 cut(s) 195, 243
FaiI YATR 3 cut(s) 193, 197, 241
FatI CATG 2 cut(s) 191, 239
FspBI CTAG 1 cut(s) 134
GlaI GCGC 1 cut(s) 76
HaeII RGCGCY 1 cut(s) 78
HaeIII GGCC 1 cut(s) 9
HhaI GCGC 1 cut(s) 77
Hin1II CATG 2 cut(s) 195, 243
Hin6I GCGC 1 cut(s) 75
HinP1I GCGC 1 cut(s) 75
HinfI GANTC 1 cut(s) 260
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 265
Hpy188III TCNNGA 1 cut(s) 134
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 20, 55
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4IV ACGT 1 cut(s) 214
HpyCH4V TGCA 1 cut(s) 195
HpySE526I ACGT 1 cut(s) 214
Hsp92II CATG 2 cut(s) 195, 243
HspAI GCGC 1 cut(s) 75
LpnPI CCDG 2 cut(s) 164, 191
MaeI CTAG 1 cut(s) 134
MaeII ACGT 1 cut(s) 214
MboII GAAGA 1 cut(s) 16
MluCI AATT 2 cut(s) 102, 287
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 3 cut(s) 57, 229, 250
Mph1103I ATGCAT 1 cut(s) 197
MroXI GAANNNNTTC 1 cut(s) 90
MseI TTAA 2 cut(s) 159, 231
MspR9I CCNGG 1 cut(s) 179
MvaI CCWGG 1 cut(s) 179
NcoI CCATGG 1 cut(s) 239
NlaIII CATG 2 cut(s) 195, 243
NsiI ATGCAT 1 cut(s) 197
PdmI GAANNNNTTC 1 cut(s) 90
PfeI GAWTC 1 cut(s) 260
Ppu21I YACGTR 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 177
PspGI CCWGG 1 cut(s) 177
PstNI CAGNNNCTG 1 cut(s) 184
RsaI GTAC 4 cut(s) 17, 52, 183, 213
RsaNI GTAC 4 cut(s) 16, 51, 182, 212
SaqAI TTAA 2 cut(s) 159, 231
ScrFI CCNGG 1 cut(s) 179
SetI ASST 4 cut(s) 66, 99, 183, 217
SfcI CTRYAG 1 cut(s) 222
Sse9I AATT 2 cut(s) 102, 287
SspMI CTAG 1 cut(s) 134
StyD4I CCNGG 1 cut(s) 177
StyI CCWWGG 1 cut(s) 239
TaaI ACNGT 1 cut(s) 131
TaiI ACGT 1 cut(s) 217
TaqI TCGA 1 cut(s) 79
TasI AATT 2 cut(s) 102, 287
TatI WGTACW 1 cut(s) 15
TfiI GAWTC 1 cut(s) 260
Tru1I TTAA 2 cut(s) 159, 231
Tru9I TTAA 2 cut(s) 159, 231
XbaI TCTAGA 1 cut(s) 133
XmnI GAANNNNTTC 1 cut(s) 90
XspI CTAG 1 cut(s) 134
Zsp2I ATGCAT 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.