pycom07g26420

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
26435023 .. 26435238
216 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g26420.1

Sequence Viewer

Length: 216 bp
ATGTTTTACCCAAGGGAAGGCTCAGGATTTGTGGAACACAATATGTTTGTGAATGTGTTTCTTCTCGGTCAATATGTTCCGAGGGTTCTTCGAATTCACCTGTCAGCCAAGGCATTCAAAAGGATGAATGGGAGATGGGCTAATGGTCTATTCAACTTGTTTCTCTACATTCTTGCCGGTCATGTAAGTTTTAACTTAATTGTCATTATATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.29

Weight (kDa)

10.52

Isoelectric Point (pI)

28.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018074)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 2 cut(s) 118, 154
ApoI RAATTY 1 cut(s) 93
AsuHPI GGTGA 1 cut(s) 89
AsuII TTCGAA 1 cut(s) 91
BccI CCATC 1 cut(s) 129
Bpu10I CCTNAGC 1 cut(s) 22
Bpu14I TTCGAA 1 cut(s) 91
BsaJI CCNNGG 3 cut(s) 11, 80, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse118I RCCGGY 1 cut(s) 176
BseDI CCNNGG 3 cut(s) 11, 80, 108
BseGI GGATG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 17
BseMII CTCAG 1 cut(s) 36
BsiSI CCGG 1 cut(s) 177
BslI CCNNNNNNNGG 1 cut(s) 17
BsmI GAATGC 1 cut(s) 113
Bsp119I TTCGAA 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 35
BspT104I TTCGAA 1 cut(s) 91
BsrFI RCCGGY 1 cut(s) 176
BssAI RCCGGY 1 cut(s) 176
BssECI CCNNGG 3 cut(s) 11, 80, 108
BssT1I CCWWGG 2 cut(s) 11, 108
BstBI TTCGAA 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 22
BstF5I GGATG 1 cut(s) 129
BtsCI GGATG 1 cut(s) 129
Cfr10I RCCGGY 1 cut(s) 176
CviAII CATG 1 cut(s) 182
CviJI RGCY 3 cut(s) 21, 107, 140
CviKI_1 RGCY 3 cut(s) 21, 107, 140
DdeI CTNAG 1 cut(s) 22
Eco130I CCWWGG 2 cut(s) 11, 108
EcoRI GAATTC 1 cut(s) 93
EcoT14I CCWWGG 2 cut(s) 11, 108
ErhI CCWWGG 2 cut(s) 11, 108
FaeI CATG 1 cut(s) 185
FaiI YATR 4 cut(s) 44, 75, 183, 209
FatI CATG 1 cut(s) 181
FokI GGATG 1 cut(s) 136
HapII CCGG 1 cut(s) 177
Hin1II CATG 1 cut(s) 185
HpaII CCGG 1 cut(s) 177
HphI GGTGA 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 81
Hpy188III TCNNGA 1 cut(s) 24
HpyAV CCTTC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 22
Hsp92II CATG 1 cut(s) 185
LpnPI CCDG 3 cut(s) 9, 113, 190
MboII GAAGA 2 cut(s) 53, 80
MluCI AATT 2 cut(s) 93, 198
MnlI CCTC 1 cut(s) 75
MseI TTAA 3 cut(s) 192, 197, 214
MspI CCGG 1 cut(s) 177
Mva1269I GAATGC 1 cut(s) 113
NlaIII CATG 1 cut(s) 185
NspV TTCGAA 1 cut(s) 91
PctI GAATGC 1 cut(s) 113
SaqAI TTAA 3 cut(s) 192, 197, 214
SetI ASST 1 cut(s) 102
SfuI TTCGAA 1 cut(s) 91
Sse9I AATT 2 cut(s) 93, 198
StyI CCWWGG 2 cut(s) 11, 108
TaqI TCGA 1 cut(s) 91
TaqII GACCGA 1 cut(s) 56
TasI AATT 2 cut(s) 93, 198
Tru1I TTAA 3 cut(s) 192, 197, 214
Tru9I TTAA 3 cut(s) 192, 197, 214
TspDTI ATGAA 1 cut(s) 140
XapI RAATTY 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.