pycom08g03650

Uncharacterized protein K02A2.6-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Reverse (-)
2832946 .. 2833298
353 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g03650.2

Sequence Viewer

Length: 297 bp
ATGGAAATTAATGAGATTAATGATGAACCACAAACAAGCACACGACATGTTGACAACCCTGTTCCTGAACCCCTAGCTCCACGTAGATCTGAACGGGTCAATAAGCCACCTAGAAGGTATGGCTTAGACAATGACTTTGCGGAATTGCACCTTCTAGGTGACAATGACACAAAGGAAGACCCTAGAGACTACACTGAAGCAATGTCCGACATTGATTCAAAGAGATGGCAAGAGGCTATGAAATCCGAGATGGATTCCATGTATCAAAATCAACTTCAAGAGGAAAATAGGCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.63

Weight (kDa)

4.63

Isoelectric Point (pI)

83.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018346)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 216
AflIII ACRYGT 1 cut(s) 46
AgsI TTSAA 2 cut(s) 219, 278
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Alw26I GTCTC 1 cut(s) 180
ArsI GACNNNNNNTTYG 2 cut(s) 119, 151
AseI ATTAAT 2 cut(s) 9, 18
AsuHPI GGTGA 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 183
BccI CCATC 2 cut(s) 219, 244
BcoDI GTCTC 1 cut(s) 180
BfaI CTAG 4 cut(s) 74, 111, 155, 183
BglII AGATCT 1 cut(s) 86
BpiI GAAGAC 1 cut(s) 183
BsaAI YACGTR 1 cut(s) 83
Bse3DI GCAATG 1 cut(s) 207
BseMI GCAATG 1 cut(s) 207
BsmAI GTCTC 1 cut(s) 180
Bsp143I GATC 1 cut(s) 86
BspACI CCGC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 207
BssMI GATC 1 cut(s) 86
BstBAI YACGTR 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 124
BstKTI GATC 1 cut(s) 89
BstMAI GTCTC 1 cut(s) 180
BstMBI GATC 1 cut(s) 86
BstNSI RCATGY 1 cut(s) 50
BstV2I GAAGAC 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 86
BstYI RGATCY 1 cut(s) 86
BtsIMutI CAGTG 1 cut(s) 192
CviAII CATG 2 cut(s) 47, 259
CviJI RGCY 4 cut(s) 77, 106, 123, 236
CviKI_1 RGCY 4 cut(s) 77, 106, 123, 236
DdeI CTNAG 1 cut(s) 124
DpnI GATC 1 cut(s) 88
DpnII GATC 1 cut(s) 86
Eco57I CTGAAG 1 cut(s) 216
FaeI CATG 2 cut(s) 50, 262
FaiI YATR 4 cut(s) 48, 120, 239, 260
FatI CATG 2 cut(s) 46, 258
FspBI CTAG 4 cut(s) 74, 111, 155, 183
Hin1II CATG 2 cut(s) 50, 262
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 2 cut(s) 215, 254
HphI GGTGA 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 3 cut(s) 91, 208, 247
Hpy188III TCNNGA 2 cut(s) 65, 278
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 2 cut(s) 108, 161
HpyCH4IV ACGT 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 124
HpySE526I ACGT 1 cut(s) 82
Hsp92II CATG 2 cut(s) 50, 262
Kzo9I GATC 1 cut(s) 86
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 2 cut(s) 72, 78
MaeI CTAG 4 cut(s) 74, 111, 155, 183
MaeII ACGT 1 cut(s) 82
MaeIII GTNAC 1 cut(s) 158
MalI GATC 1 cut(s) 88
MboI GATC 1 cut(s) 86
MboII GAAGA 1 cut(s) 188
MflI RGATCY 1 cut(s) 86
MluCI AATT 2 cut(s) 6, 143
MmeI TCCRAC 1 cut(s) 231
MnlI CCTC 2 cut(s) 226, 274
MseI TTAA 2 cut(s) 9, 18
NdeII GATC 1 cut(s) 86
NlaIII CATG 2 cut(s) 50, 262
NmuCI GTSAC 1 cut(s) 158
NspI RCATGY 1 cut(s) 50
PciI ACATGT 1 cut(s) 46
PfeI GAWTC 2 cut(s) 215, 254
Ppu21I YACGTR 1 cut(s) 83
PscI ACATGT 1 cut(s) 46
PshBI ATTAAT 2 cut(s) 9, 18
PsuI RGATCY 1 cut(s) 86
SaqAI TTAA 2 cut(s) 9, 18
Sau3AI GATC 1 cut(s) 86
SetI ASST 6 cut(s) 79, 85, 112, 119, 153, 160
Sse9I AATT 2 cut(s) 6, 143
SsiI CCGC 1 cut(s) 140
SspMI CTAG 4 cut(s) 74, 111, 155, 183
TaiI ACGT 1 cut(s) 85
TasI AATT 2 cut(s) 6, 143
TfiI GAWTC 2 cut(s) 215, 254
Tru1I TTAA 2 cut(s) 9, 18
Tru9I TTAA 2 cut(s) 9, 18
TscAI CASTG 1 cut(s) 199
TseFI GTSAC 1 cut(s) 158
Tsp45I GTSAC 1 cut(s) 158
TspDTI ATGAA 2 cut(s) 39, 254
TspRI CASTG 1 cut(s) 199
VspI ATTAAT 2 cut(s) 9, 18
XceI RCATGY 1 cut(s) 50
XspI CTAG 4 cut(s) 74, 111, 155, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.