Rw4G005310

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0018346
Physical Location & Seq
Reverse (-)
10738754 .. 10739101
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G005310.1

Sequence Viewer

Length: 348 bp
ATGGAATCCTCGGAAACACCTTATTGGAAAGAGGCTATTCAAAATGAAGTGGAATCCATTATACAAAATAATACTTGGACATTGGTTGATTTGCCTCCTGGACATAAACCAATAGGCCATAAATGGATTTTTAAAAGAAAGATGAGACCTGATGGTACCATAGAAAAATATAAAGCTCGTATAGTAGCTAAAGGGTATCGTCAAAAAGAAGGTGTAGATTTTTTCGACACTTATTCGCCGGTGACAAGAATTACGTCCATACGAACTCTAATTGCTATAGCGGCTGTACACAATGGAAATACACCAAATGGATGTGAAAACCGCATTTCTAAATGGCGAACTAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

115

Amino Acids

13.33

Weight (kDa)

9.76

Isoelectric Point (pI)

24.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 23 - 98 1.9e-23 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018346)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g09832
malus_domestica MD17G1125600.v1.1
pyrus_communis pycom07g08290 pycom08g03650 pycom10g05700 pycom13g21050 pycom17g16760
rosa_wichuraiana Rw1G014600 Rw4G005310 Rw4G016610

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 155
AccB1I GGYRCC 1 cut(s) 155
AciI CCGC 2 cut(s) 281, 322
AfaI GTAC 2 cut(s) 157, 288
AgsI TTSAA 1 cut(s) 41
AjnI CCWGG 1 cut(s) 97
AluBI AGCT 2 cut(s) 176, 188
AluI AGCT 2 cut(s) 176, 188
Alw26I GTCTC 1 cut(s) 139
AoxI GGCC 1 cut(s) 115
Asp718I GGTACC 1 cut(s) 155
AsuHPI GGTGA 1 cut(s) 253
BanI GGYRCC 1 cut(s) 155
BccI CCATC 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 139
BfaI CTAG 1 cut(s) 342
BfmI CTRYAG 1 cut(s) 276
BisI GCNGC 1 cut(s) 282
BlsI GCNGC 1 cut(s) 283
Bme1390I CCNGG 1 cut(s) 99
BmiI GGNNCC 1 cut(s) 157
BmrFI CCNGG 1 cut(s) 99
BsaI GGTCTC 1 cut(s) 139
BsaJI CCNNGG 1 cut(s) 9
Bse118I RCCGGY 1 cut(s) 238
BseBI CCWGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 1 cut(s) 317
BshFI GGCC 1 cut(s) 117
BshNI GGYRCC 1 cut(s) 155
BsiSI CCGG 1 cut(s) 239
BsmAI GTCTC 1 cut(s) 139
BsnI GGCC 1 cut(s) 117
Bso31I GGTCTC 1 cut(s) 139
Bsp1407I TGTACA 1 cut(s) 286
BspACI CCGC 2 cut(s) 281, 322
BspANI GGCC 1 cut(s) 117
BspLI GGNNCC 1 cut(s) 157
BspT107I GGYRCC 1 cut(s) 155
BspTNI GGTCTC 1 cut(s) 139
BsrFI RCCGGY 1 cut(s) 238
BsrGI TGTACA 1 cut(s) 286
BssAI RCCGGY 1 cut(s) 238
BssECI CCNNGG 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 99
BstAUI TGTACA 1 cut(s) 286
BstF5I GGATG 1 cut(s) 317
BstMAI GTCTC 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 281
BstNI CCWGG 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 97
BstSFI CTRYAG 1 cut(s) 276
BsuRI GGCC 1 cut(s) 117
BtsCI GGATG 1 cut(s) 317
Cfr10I RCCGGY 1 cut(s) 238
Csp6I GTAC 2 cut(s) 156, 287
CviJI RGCY 5 cut(s) 35, 117, 176, 188, 284
CviKI_1 RGCY 5 cut(s) 35, 117, 176, 188, 284
CviQI GTAC 2 cut(s) 156, 287
DraI TTTAAA 1 cut(s) 133
Eco31I GGTCTC 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 97
FaiI YATR 8 cut(s) 62, 105, 120, 161, 171, 182, 260, 278
Fnu4HI GCNGC 1 cut(s) 282
FokI GGATG 1 cut(s) 324
Fsp4HI GCNGC 1 cut(s) 282
FspBI CTAG 1 cut(s) 342
GluI GCNGC 1 cut(s) 282
HaeIII GGCC 1 cut(s) 117
HapII CCGG 1 cut(s) 239
HinfI GANTC 2 cut(s) 5, 53
HpaII CCGG 1 cut(s) 239
HphI GGTGA 1 cut(s) 253
Hpy166II GTNNAC 1 cut(s) 289
Hpy188I TCNGA 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 289
HpyAV CCTTC 1 cut(s) 203
HpyCH4IV ACGT 1 cut(s) 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 281
HpySE526I ACGT 1 cut(s) 254
KpnI GGTACC 1 cut(s) 159
LpnPI CCDG 4 cut(s) 84, 111, 162, 252
MaeI CTAG 1 cut(s) 342
MaeII ACGT 1 cut(s) 254
MaeIII GTNAC 1 cut(s) 241
MluCI AATT 2 cut(s) 249, 270
MnlI CCTC 3 cut(s) 19, 25, 105
MseI TTAA 1 cut(s) 132
MspI CCGG 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 99
MvaI CCWGG 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 281
NlaIV GGNNCC 1 cut(s) 157
NmuCI GTSAC 1 cut(s) 241
PfeI GAWTC 2 cut(s) 5, 53
PfoI TCCNGGA 1 cut(s) 97
PkrI GCNGC 1 cut(s) 283
Psp6I CCWGG 1 cut(s) 97
PspGI CCWGG 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 157
RsaI GTAC 2 cut(s) 157, 288
RsaNI GTAC 2 cut(s) 156, 287
SaqAI TTAA 1 cut(s) 132
SatI GCNGC 1 cut(s) 282
ScrFI CCNGG 1 cut(s) 99
SetI ASST 6 cut(s) 22, 151, 178, 190, 214, 257
SfcI CTRYAG 1 cut(s) 276
SgeI CNNG 8 cut(s) 22, 87, 110, 111, 161, 189, 251, 258
SgrAI CRCCGGYG 1 cut(s) 238
Sse9I AATT 2 cut(s) 249, 270
SsiI CCGC 2 cut(s) 281, 322
SspMI CTAG 1 cut(s) 342
StyD4I CCNGG 1 cut(s) 97
TaiI ACGT 1 cut(s) 257
TaqI TCGA 1 cut(s) 225
TasI AATT 2 cut(s) 249, 270
TatI WGTACW 1 cut(s) 286
TauI GCSGC 1 cut(s) 284
TfiI GAWTC 2 cut(s) 5, 53
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TseFI GTSAC 1 cut(s) 241
Tsp45I GTSAC 1 cut(s) 241
TspDTI ATGAA 1 cut(s) 60
XspI CTAG 1 cut(s) 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.