pycom13g21050

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
17276910 .. 17277673
764 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g21050.2

Sequence Viewer

Length: 723 bp
ATGTGTGGGGTTGCAAAGAAGAAAACCAATTCATGCTACTTTGTGGGGTATTCTGACAAATATAAGGGTTTCAAGTTTTATTGTCCTCAAGCACAAACAAGAATCCAAGATACTCATAATGCAATTTTCTTAGAAGACCAAGATGTATCATATCTAGTACAAGACACTTTTGAGTTTGAAGAATCTGAACAACTTGATGGTTCAATTCCAATGGACTATAATCACATCTCAGTGTTGCCGAGAAATCATGCAGAGAGAGATGATTTTGGTGAAGAGATGACACTCGATATAGGTGCTTATATGCAAGCTAAACATGATGGTACTTCTTATGCACAAGATATATCTCTTAATGCTCAAAGTTCTCATATTGATAGAGACATTGGTCCAGTAGGTGATCAATTGAATATGAGGAAGTCCAGTAGAGTTAAAAAACTAGCTATTTCAATTGATTATGTCTATCTCCAAGAAGCAGAATTCGACATAGGGGACATTGATGATCATGTTACTTACCAGCAAGCAATTCAATGTCCTCAAGTTGCATTATGGAAGAAAGCAATGGAGGAAAAGCTGGATTCCATGTTCAAAAATAAGGTTTGGACACTTGTGAACTCCACTTTTGAAACAAAACCAATTGGTTGCAAGTGGGTTTACAAAACTAAAAGGGATACTACAGGGAAAATAAAGAGATATAAGGCACAGTTGGTAGCCAAGGGCTTCACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

241

Amino Acids

27.61

Weight (kDa)

5.89

Isoelectric Point (pI)

35.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018346)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 473
AfaI GTAC 2 cut(s) 159, 322
AgsI TTSAA 8 cut(s) 73, 179, 204, 403, 444, 524, 583, 620
AloI GAACNNNNNNTCC 2 cut(s) 563, 595
AluBI AGCT 3 cut(s) 308, 437, 568
AluI AGCT 3 cut(s) 308, 437, 568
Alw26I GTCTC 1 cut(s) 369
ApoI RAATTY 1 cut(s) 473
AspS9I GGNCC 1 cut(s) 383
AsuHPI GGTGA 2 cut(s) 281, 404
AvaII GGWCC 1 cut(s) 383
BbsI GAAGAC 1 cut(s) 141
BccI CCATC 2 cut(s) 191, 311
BcgI CGANNNNNNTGC 2 cut(s) 275, 309
BciVI GTATCC 1 cut(s) 658
BclI TGATCA 2 cut(s) 394, 496
BcoDI GTCTC 1 cut(s) 369
BfaI CTAG 2 cut(s) 155, 434
BfmI CTRYAG 1 cut(s) 669
BfuI GTATCC 1 cut(s) 658
Bme18I GGWCC 1 cut(s) 383
BmgT120I GGNCC 1 cut(s) 383
BoxI GACNNNNGTC 1 cut(s) 381
BpiI GAAGAC 1 cut(s) 141
BpuEI CTTGAG 2 cut(s) 72, 516
BsaJI CCNNGG 1 cut(s) 708
Bse1I ACTGG 2 cut(s) 386, 417
Bse3DI GCAATG 1 cut(s) 561
BseDI CCNNGG 1 cut(s) 708
BseMI GCAATG 1 cut(s) 561
BseMII CTCAG 1 cut(s) 243
BseNI ACTGG 2 cut(s) 386, 417
BslFI GGGAC 1 cut(s) 500
BsmAI GTCTC 1 cut(s) 369
BsmFI GGGAC 1 cut(s) 500
Bsp143I GATC 2 cut(s) 394, 496
BspCNI CTCAG 1 cut(s) 242
BsrDI GCAATG 1 cut(s) 561
BsrI ACTGG 2 cut(s) 386, 417
BssECI CCNNGG 1 cut(s) 708
BssMI GATC 2 cut(s) 394, 496
BssT1I CCWWGG 1 cut(s) 708
Bst4CI ACNGT 1 cut(s) 699
Bst6I CTCTTC 1 cut(s) 267
BstC8I GCNNGC 2 cut(s) 306, 516
BstDEI CTNAG 3 cut(s) 130, 229, 720
BstKTI GATC 2 cut(s) 397, 499
BstMAI GTCTC 1 cut(s) 369
BstMBI GATC 2 cut(s) 394, 496
BstPAI GACNNNNGTC 1 cut(s) 381
BstSFI CTRYAG 1 cut(s) 669
BstV2I GAAGAC 1 cut(s) 141
BsuI GTATCC 1 cut(s) 658
BtsIMutI CAGTG 1 cut(s) 237
Cac8I GCNNGC 2 cut(s) 306, 516
Cfr13I GGNCC 1 cut(s) 383
Csp6I GTAC 2 cut(s) 158, 321
CviAII CATG 5 cut(s) 33, 248, 314, 500, 577
CviJI RGCY 5 cut(s) 308, 437, 568, 707, 714
CviKI_1 RGCY 5 cut(s) 308, 437, 568, 707, 714
CviQI GTAC 2 cut(s) 158, 321
DdeI CTNAG 3 cut(s) 130, 229, 720
DpnI GATC 2 cut(s) 396, 498
DpnII GATC 2 cut(s) 394, 496
Eam1104I CTCTTC 1 cut(s) 267
EarI CTCTTC 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 708
Eco47I GGWCC 1 cut(s) 383
EcoRI GAATTC 1 cut(s) 473
EcoT14I CCWWGG 1 cut(s) 708
ErhI CCWWGG 1 cut(s) 708
FaeI CATG 5 cut(s) 36, 251, 317, 503, 580
FaqI GGGAC 1 cut(s) 500
FatI CATG 5 cut(s) 32, 247, 313, 499, 576
FbaI TGATCA 2 cut(s) 394, 496
FspBI CTAG 2 cut(s) 155, 434
Hin1II CATG 5 cut(s) 36, 251, 317, 503, 580
HinfI GANTC 3 cut(s) 102, 182, 572
HphI GGTGA 2 cut(s) 281, 404
Hpy166II GTNNAC 2 cut(s) 607, 649
Hpy188I TCNGA 2 cut(s) 55, 187
Hpy8I GTNNAC 2 cut(s) 607, 649
HpyCH4III ACNGT 1 cut(s) 699
HpyCH4V TGCA 7 cut(s) 14, 122, 251, 304, 332, 539, 639
HpyF3I CTNAG 3 cut(s) 130, 229, 720
Hsp92II CATG 5 cut(s) 36, 251, 317, 503, 580
Ksp22I TGATCA 2 cut(s) 394, 496
Kzo9I GATC 2 cut(s) 394, 496
LpnPI CCDG 5 cut(s) 399, 430, 524, 554, 657
MaeI CTAG 2 cut(s) 155, 434
MaeIII GTNAC 1 cut(s) 502
MalI GATC 2 cut(s) 396, 498
MboI GATC 2 cut(s) 394, 496
MboII GAAGA 5 cut(s) 31, 146, 191, 284, 559
MfeI CAATTG 3 cut(s) 398, 444, 630
MluCI AATT 8 cut(s) 28, 123, 204, 398, 444, 473, 519, 630
MnlI CCTC 4 cut(s) 96, 402, 540, 553
MseI TTAA 2 cut(s) 348, 426
MslI CAYNNNNRTG 1 cut(s) 230
MunI CAATTG 3 cut(s) 398, 444, 630
NdeII GATC 2 cut(s) 394, 496
NlaIII CATG 5 cut(s) 36, 251, 317, 503, 580
NmeAIII GCCGAG 1 cut(s) 264
PfeI GAWTC 3 cut(s) 102, 182, 572
PshAI GACNNNNGTC 1 cut(s) 381
PspPI GGNCC 1 cut(s) 383
RsaI GTAC 2 cut(s) 159, 322
RsaNI GTAC 2 cut(s) 158, 321
RseI CAYNNNNRTG 1 cut(s) 230
SaqAI TTAA 2 cut(s) 348, 426
Sau3AI GATC 2 cut(s) 394, 496
Sau96I GGNCC 1 cut(s) 383
SetI ASST 6 cut(s) 295, 310, 394, 439, 570, 594
SfcI CTRYAG 1 cut(s) 669
SinI GGWCC 1 cut(s) 383
SmiMI CAYNNNNRTG 1 cut(s) 230
SmlI CTYRAG 2 cut(s) 87, 531
SmoI CTYRAG 2 cut(s) 87, 531
Sse9I AATT 8 cut(s) 28, 123, 204, 398, 444, 473, 519, 630
SspMI CTAG 2 cut(s) 155, 434
StyI CCWWGG 1 cut(s) 708
TaaI ACNGT 1 cut(s) 699
TaqI TCGA 2 cut(s) 285, 477
TasI AATT 8 cut(s) 28, 123, 204, 398, 444, 473, 519, 630
TatI WGTACW 1 cut(s) 157
TfiI GAWTC 3 cut(s) 102, 182, 572
Tru1I TTAA 2 cut(s) 348, 426
Tru9I TTAA 2 cut(s) 348, 426
TscAI CASTG 1 cut(s) 237
TspDTI ATGAA 1 cut(s) 21
TspRI CASTG 1 cut(s) 237
VpaK11BI GGWCC 1 cut(s) 383
XapI RAATTY 1 cut(s) 473
XspI CTAG 2 cut(s) 155, 434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.