pycom09g03940

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
2939076 .. 2939498
423 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 423 bp
ATGGAGGTTGCTCAAAATTCAATTCAATCCAAAAAACGCTACCAGAGGCTGGCGTGGTTCTTGCATGACCCAGGGAACATGTCATCGTTAAGCAAGAACCTCCTTACAGAGACATATATGACAGTGGGGTTGACGAAGGCACAAGAGAGGGAGGTCTGTGTGGATTCATTCTTGCCATCACCATCTCAAACAACCAAGTATTCATGGGAGTTCTCAAGATCCGTCGAAAACAACGTGATCTGGGTTTCCAAGTCTGATGAGATTCTTCTGGATTTCTGGAAACCAGTTGTCAAGTACGAGTTTTCTCATCTCGTGACGACTTCAGGTCGTAAATTTCAATTTTTCACCGGAATTCGGTGGGGCGCTTCTGGCGCAGTGGGAGAGACGAAAAATGGACATACCTTTTATTCTGTGAGATTTTAG

Protein Analysis

141

Amino Acids

16.16

Weight (kDa)

9.27

Isoelectric Point (pI)

38.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 49
AclWI GGATC 1 cut(s) 213
AcsI RAATTY 3 cut(s) 16, 332, 351
AcuI CTGAAG 1 cut(s) 306
AfaI GTAC 1 cut(s) 296
AfiI CCNNNNNNNGG 2 cut(s) 49, 354
AflIII ACRYGT 1 cut(s) 78
AgsI TTSAA 3 cut(s) 21, 26, 338
AhdI GACNNNNNGTC 1 cut(s) 324
AjnI CCWGG 1 cut(s) 70
Alw26I GTCTC 2 cut(s) 104, 377
AlwI GGATC 1 cut(s) 213
AlwNI CAGNNNCTG 1 cut(s) 49
ApoI RAATTY 3 cut(s) 16, 332, 351
AspLEI GCGC 2 cut(s) 365, 374
AsuHPI GGTGA 2 cut(s) 171, 337
BauI CACGAG 1 cut(s) 311
BccI CCATC 2 cut(s) 184, 190
BciT130I CCWGG 1 cut(s) 72
BcoDI GTCTC 2 cut(s) 104, 377
BfoI RGCGCY 1 cut(s) 366
Bme1390I CCNGG 1 cut(s) 72
BmeRI GACNNNNNGTC 1 cut(s) 324
BmrFI CCNGG 1 cut(s) 72
BpuEI CTTGAG 1 cut(s) 199
BsaJI CCNNGG 2 cut(s) 70, 71
BsaWI WCCGGW 1 cut(s) 347
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 354
Bse1I ACTGG 1 cut(s) 284
BseBI CCWGG 1 cut(s) 72
BseDI CCNNGG 2 cut(s) 70, 71
BseLI CCNNNNNNNGG 2 cut(s) 49, 354
BseNI ACTGG 1 cut(s) 284
BsiSI CCGG 1 cut(s) 348
BslI CCNNNNNNNGG 2 cut(s) 49, 354
BsmAI GTCTC 2 cut(s) 104, 377
BsmBI CGTCTC 1 cut(s) 377
Bsp143I GATC 2 cut(s) 218, 237
BspPI GGATC 1 cut(s) 213
BsrI ACTGG 1 cut(s) 284
BssECI CCNNGG 2 cut(s) 70, 71
BssMI GATC 2 cut(s) 218, 237
BssSI CACGAG 1 cut(s) 311
Bst2BI CACGAG 1 cut(s) 311
Bst2UI CCWGG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 51
BstH2I RGCGCY 1 cut(s) 366
BstHHI GCGC 2 cut(s) 365, 374
BstKTI GATC 2 cut(s) 221, 240
BstMAI GTCTC 2 cut(s) 104, 377
BstMBI GATC 2 cut(s) 218, 237
BstMWI GCNNNNNNNGC 2 cut(s) 369, 371
BstNI CCWGG 1 cut(s) 72
BstNSI RCATGY 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 70
BstX2I RGATCY 1 cut(s) 218
BstYI RGATCY 1 cut(s) 218
BtsI GCAGTG 1 cut(s) 381
BtsIMutI CAGTG 2 cut(s) 129, 381
Cac8I GCNNGC 1 cut(s) 51
CaiI CAGNNNCTG 1 cut(s) 49
CfoI GCGC 2 cut(s) 365, 374
Csp6I GTAC 1 cut(s) 295
CviAII CATG 3 cut(s) 65, 79, 204
CviJI RGCY 1 cut(s) 49
CviKI_1 RGCY 1 cut(s) 49
CviQI GTAC 1 cut(s) 295
DpnI GATC 2 cut(s) 220, 239
DpnII GATC 2 cut(s) 218, 237
DriI GACNNNNNGTC 1 cut(s) 324
Eam1105I GACNNNNNGTC 1 cut(s) 324
Eco57I CTGAAG 1 cut(s) 306
EcoRI GAATTC 1 cut(s) 351
EcoRII CCWGG 1 cut(s) 70
Esp3I CGTCTC 1 cut(s) 377
FaeI CATG 3 cut(s) 68, 82, 207
FaiI YATR 7 cut(s) 66, 80, 115, 117, 119, 205, 399
FatI CATG 3 cut(s) 64, 78, 203
GlaI GCGC 2 cut(s) 364, 373
HaeII RGCGCY 1 cut(s) 366
HapII CCGG 1 cut(s) 348
HhaI GCGC 2 cut(s) 365, 374
Hin1II CATG 3 cut(s) 68, 82, 207
Hin6I GCGC 2 cut(s) 363, 372
HinP1I GCGC 2 cut(s) 363, 372
HincII GTYRAC 1 cut(s) 132
HindII GTYRAC 1 cut(s) 132
HinfI GANTC 2 cut(s) 164, 262
HpaII CCGG 1 cut(s) 348
HphI GGTGA 2 cut(s) 171, 337
Hpy166II GTNNAC 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 4 cut(s) 216, 269, 277, 313
Hpy8I GTNNAC 1 cut(s) 132
Hpy99I CGWCG 1 cut(s) 227
HpyAV CCTTC 1 cut(s) 130
HpyCH4III ACNGT 1 cut(s) 124
HpyCH4IV ACGT 1 cut(s) 234
HpyCH4V TGCA 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 2 cut(s) 369, 371
HpySE526I ACGT 1 cut(s) 234
Hsp92II CATG 3 cut(s) 68, 82, 207
HspAI GCGC 2 cut(s) 363, 372
Kzo9I GATC 2 cut(s) 218, 237
MaeII ACGT 1 cut(s) 234
MaeIII GTNAC 1 cut(s) 313
MalI GATC 2 cut(s) 220, 239
MboI GATC 2 cut(s) 218, 237
MboII GAAGA 1 cut(s) 257
MflI RGATCY 1 cut(s) 218
MluCI AATT 5 cut(s) 16, 21, 332, 338, 351
MnlI CCTC 4 cut(s) 39, 110, 141, 145
MseI TTAA 1 cut(s) 89
MspI CCGG 1 cut(s) 348
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
MwoI GCNNNNNNNGC 2 cut(s) 369, 371
NdeII GATC 2 cut(s) 218, 237
NlaIII CATG 3 cut(s) 68, 82, 207
NmuCI GTSAC 1 cut(s) 313
NspI RCATGY 1 cut(s) 82
PasI CCCWGGG 1 cut(s) 71
PciI ACATGT 1 cut(s) 78
PcsI WCGNNNNNNNCGW 1 cut(s) 231
PfeI GAWTC 2 cut(s) 164, 262
PflMI CCANNNNNTGG 1 cut(s) 49
PscI ACATGT 1 cut(s) 78
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PstNI CAGNNNCTG 1 cut(s) 49
PsuI RGATCY 1 cut(s) 218
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
SaqAI TTAA 1 cut(s) 89
Sau3AI GATC 2 cut(s) 218, 237
ScrFI CCNGG 1 cut(s) 72
SetI ASST 6 cut(s) 9, 102, 156, 237, 328, 404
SmlI CTYRAG 1 cut(s) 214
SmoI CTYRAG 1 cut(s) 214
Sse9I AATT 5 cut(s) 16, 21, 332, 338, 351
StyD4I CCNGG 1 cut(s) 70
TaaI ACNGT 1 cut(s) 124
TaiI ACGT 1 cut(s) 237
TaqI TCGA 1 cut(s) 225
TasI AATT 5 cut(s) 16, 21, 332, 338, 351
TfiI GAWTC 2 cut(s) 164, 262
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
TscAI CASTG 2 cut(s) 129, 381
TseFI GTSAC 1 cut(s) 313
Tsp45I GTSAC 1 cut(s) 313
TspDTI ATGAA 2 cut(s) 156, 192
TspGWI ACGGA 1 cut(s) 211
TspRI CASTG 2 cut(s) 129, 381
Van91I CCANNNNNTGG 1 cut(s) 49
XapI RAATTY 3 cut(s) 16, 332, 351
XceI RCATGY 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.