pycom13g25220

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0008210
Physical Location & Seq
Forward (+)
22099116 .. 22099340
225 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGGGACTCAATGATCCTGCTTCGGCTGAGGGGTTGACTGTGATCTTTAACAAGGCTAGGGATGAGAAGAAGACAGGTGGAAAACCAGAGTCACCAGGAAAGGTTGATCCTAATATCAGGCATGGAGGAGGAGTGGATCCTGGCACTGGCAGTCCTTCGTCTGTAAGATTTTTTCTCATTAACTGTTGTCTCGTTTCTTTCTCTAATGATTTGATATATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

75

Amino Acids

7.78

Weight (kDa)

6.53

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 4 - 24 2.9e-08 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 8, 101, 131, 144
AfiI CCNNNNNNNGG 1 cut(s) 146
AjnI CCWGG 2 cut(s) 94, 139
Alw26I GTCTC 1 cut(s) 194
AlwI GGATC 4 cut(s) 8, 101, 131, 144
AsuHPI GGTGA 1 cut(s) 84
BamHI GGATCC 1 cut(s) 136
BbsI GAAGAC 1 cut(s) 77
BbvCI CCTCAGC 1 cut(s) 27
BciT130I CCWGG 2 cut(s) 96, 141
BcoDI GTCTC 1 cut(s) 194
BfaI CTAG 1 cut(s) 57
Bme1390I CCNGG 2 cut(s) 96, 141
BmiI GGNNCC 1 cut(s) 138
BmrFI CCNGG 2 cut(s) 96, 141
BpiI GAAGAC 1 cut(s) 77
Bpu10I CCTNAGC 1 cut(s) 27
BsaXI ACNNNNNCTCC 2 cut(s) 117, 147
Bsc4I CCNNNNNNNGG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 151
BseBI CCWGG 2 cut(s) 96, 141
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 146
BseMII CTCAG 1 cut(s) 18
BseNI ACTGG 1 cut(s) 151
BseRI GAGGAG 2 cut(s) 141, 144
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 18
Bsp143I GATC 4 cut(s) 13, 42, 106, 136
BspCNI CTCAG 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 4 cut(s) 8, 101, 131, 144
BsrI ACTGG 1 cut(s) 151
BssMI GATC 4 cut(s) 13, 42, 106, 136
Bst2UI CCWGG 2 cut(s) 96, 141
Bst4CI ACNGT 2 cut(s) 40, 185
BstDEI CTNAG 1 cut(s) 27
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 4 cut(s) 16, 45, 109, 139
BstMAI GTCTC 1 cut(s) 194
BstMBI GATC 4 cut(s) 13, 42, 106, 136
BstNI CCWGG 2 cut(s) 96, 141
BstSCI CCNGG 2 cut(s) 94, 139
BstV2I GAAGAC 1 cut(s) 77
BstX2I RGATCY 1 cut(s) 136
BstYI RGATCY 1 cut(s) 136
BtsCI GGATG 1 cut(s) 67
BtsIMutI CAGTG 1 cut(s) 144
CviAII CATG 2 cut(s) 122, 222
CviJI RGCY 2 cut(s) 26, 56
CviKI_1 RGCY 2 cut(s) 26, 56
DdeI CTNAG 1 cut(s) 27
DpnI GATC 4 cut(s) 15, 44, 108, 138
DpnII GATC 4 cut(s) 13, 42, 106, 136
EcoRII CCWGG 2 cut(s) 94, 139
FaeI CATG 2 cut(s) 125, 225
FaiI YATR 4 cut(s) 123, 217, 219, 223
FaqI GGGAC 1 cut(s) 18
FatI CATG 2 cut(s) 121, 221
FokI GGATG 1 cut(s) 74
FspBI CTAG 1 cut(s) 57
Hin1II CATG 2 cut(s) 125, 225
HincII GTYRAC 1 cut(s) 36
HindII GTYRAC 1 cut(s) 36
HinfI GANTC 2 cut(s) 6, 89
HphI GGTGA 1 cut(s) 84
Hpy166II GTNNAC 1 cut(s) 36
Hpy8I GTNNAC 1 cut(s) 36
HpyAV CCTTC 1 cut(s) 165
HpyCH4III ACNGT 2 cut(s) 40, 185
HpyF3I CTNAG 1 cut(s) 27
Hsp92II CATG 2 cut(s) 125, 225
Kzo9I GATC 4 cut(s) 13, 42, 106, 136
LpnPI CCDG 9 cut(s) 30, 60, 81, 99, 103, 108, 126, 132, 153
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 90
MalI GATC 4 cut(s) 15, 44, 108, 138
MboI GATC 4 cut(s) 13, 42, 106, 136
MboII GAAGA 2 cut(s) 79, 82
MflI RGATCY 1 cut(s) 136
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 3 cut(s) 22, 119, 122
MseI TTAA 2 cut(s) 48, 180
MspR9I CCNGG 2 cut(s) 96, 141
MvaI CCWGG 2 cut(s) 96, 141
NdeII GATC 4 cut(s) 13, 42, 106, 136
NlaIII CATG 2 cut(s) 125, 225
NlaIV GGNNCC 1 cut(s) 138
NmuCI GTSAC 1 cut(s) 90
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
Psp6I CCWGG 2 cut(s) 94, 139
PspGI CCWGG 2 cut(s) 94, 139
PspN4I GGNNCC 1 cut(s) 138
PsuI RGATCY 1 cut(s) 136
SaqAI TTAA 2 cut(s) 48, 180
Sau3AI GATC 4 cut(s) 13, 42, 106, 136
SchI GAGTC 1 cut(s) 98
ScrFI CCNGG 2 cut(s) 96, 141
SetI ASST 2 cut(s) 79, 105
SspMI CTAG 1 cut(s) 57
StyD4I CCNGG 2 cut(s) 94, 139
TaaI ACNGT 2 cut(s) 40, 185
Tru1I TTAA 2 cut(s) 48, 180
Tru9I TTAA 2 cut(s) 48, 180
TscAI CASTG 1 cut(s) 151
TseFI GTSAC 1 cut(s) 90
Tsp45I GTSAC 1 cut(s) 90
TspRI CASTG 1 cut(s) 151
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.