RchiOBHm_Chr5g0076961

Cleavage site for pathogenic type III effector avirulence factor Avr

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
82755208 .. 82758484
3277 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35159

Sequence Viewer

Length: 237 bp
ATGTCGGAAAAGGGTAGACCTCTCCCAAAATTTGGTGAATGGGATGTCAATGATCCTGCTTCAGCAGAAGGGTTTACTGTGATTTTTAACAAGGCTAGGGATGAAAAAAAGACAGGTGGCAAACCTGAGTCACCAACCAAGGCTGCTCAGAATAATGTCAGGCCTGGAGTGGATCCTAACAGGCCACCATCTAAAAAATGGTTTTGCTGCATGGCCCAACCACCTACACAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.59

Weight (kDa)

9.34

Isoelectric Point (pI)

56.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 3 - 37 2.6e-20 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 32
AccI GTMKAC 1 cut(s) 16
AclWI GGATC 3 cut(s) 47, 167, 180
AcsI RAATTY 1 cut(s) 29
AcuI CTGAAG 1 cut(s) 45
AfiI CCNNNNNNNGG 1 cut(s) 32
AjnI CCWGG 1 cut(s) 163
AlwI GGATC 3 cut(s) 47, 167, 180
AoxI GGCC 3 cut(s) 161, 182, 213
ApeKI GCWGC 2 cut(s) 143, 207
ApoI RAATTY 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 214
AsuHPI GGTGA 2 cut(s) 47, 123
BamHI GGATCC 1 cut(s) 172
BbvI GCAGC 2 cut(s) 130, 194
BccI CCATC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 165
BfaI CTAG 1 cut(s) 96
BisI GCNGC 2 cut(s) 144, 208
BlsI GCNGC 2 cut(s) 145, 209
Bme1390I CCNGG 1 cut(s) 165
BmgT120I GGNCC 1 cut(s) 214
BmiI GGNNCC 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 165
BpmI CTGGAG 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 32
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 2 cut(s) 49, 106
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMII CTCAG 2 cut(s) 117, 161
BseXI GCAGC 2 cut(s) 130, 194
BshFI GGCC 3 cut(s) 163, 184, 215
BslI CCNNNNNNNGG 1 cut(s) 32
BsnI GGCC 3 cut(s) 163, 184, 215
Bsp143I GATC 2 cut(s) 52, 172
BspANI GGCC 3 cut(s) 163, 184, 215
BspCNI CTCAG 2 cut(s) 118, 160
BspLI GGNNCC 1 cut(s) 174
BspPI GGATC 3 cut(s) 47, 167, 180
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 2 cut(s) 52, 172
BssT1I CCWWGG 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 1 cut(s) 79
BstDEI CTNAG 2 cut(s) 126, 147
BstF5I GGATG 2 cut(s) 49, 106
BstKTI GATC 2 cut(s) 55, 175
BstMBI GATC 2 cut(s) 52, 172
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BstV1I GCAGC 2 cut(s) 130, 194
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuRI GGCC 3 cut(s) 163, 184, 215
BtsCI GGATG 2 cut(s) 49, 106
Cfr13I GGNCC 1 cut(s) 214
CviAII CATG 1 cut(s) 211
CviJI RGCY 5 cut(s) 95, 143, 163, 184, 215
CviKI_1 RGCY 5 cut(s) 95, 143, 163, 184, 215
DdeI CTNAG 2 cut(s) 126, 147
DpnI GATC 2 cut(s) 54, 174
DpnII GATC 2 cut(s) 52, 172
Eco130I CCWWGG 1 cut(s) 138
Eco147I AGGCCT 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 214
FaiI YATR 1 cut(s) 212
FatI CATG 1 cut(s) 210
FblI GTMKAC 1 cut(s) 16
Fnu4HI GCNGC 2 cut(s) 144, 208
FokI GGATG 2 cut(s) 56, 113
Fsp4HI GCNGC 2 cut(s) 144, 208
FspBI CTAG 1 cut(s) 96
GluI GCNGC 2 cut(s) 144, 208
GsuI CTGGAG 1 cut(s) 186
HaeIII GGCC 3 cut(s) 163, 184, 215
Hin1II CATG 1 cut(s) 214
HinfI GANTC 1 cut(s) 128
HphI GGTGA 2 cut(s) 47, 123
Hpy166II GTNNAC 2 cut(s) 17, 75
Hpy188I TCNGA 2 cut(s) 7, 150
Hpy188III TCNNGA 1 cut(s) 234
Hpy8I GTNNAC 2 cut(s) 17, 75
HpyAV CCTTC 1 cut(s) 62
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 210
HpyF3I CTNAG 2 cut(s) 126, 147
Hsp92II CATG 1 cut(s) 214
Kzo9I GATC 2 cut(s) 52, 172
LpnPI CCDG 7 cut(s) 69, 99, 138, 145, 150, 166, 177
Lsp1109I GCAGC 2 cut(s) 130, 194
MaeI CTAG 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 129
MalI GATC 2 cut(s) 54, 174
MboI GATC 2 cut(s) 52, 172
MflI RGATCY 1 cut(s) 172
MluCI AATT 1 cut(s) 29
MlyI GAGTC 1 cut(s) 137
MnlI CCTC 1 cut(s) 30
MseI TTAA 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
NdeII GATC 2 cut(s) 52, 172
NlaIII CATG 1 cut(s) 214
NlaIV GGNNCC 1 cut(s) 174
NmuCI GTSAC 1 cut(s) 129
PceI AGGCCT 1 cut(s) 163
PflMI CCANNNNNTGG 1 cut(s) 32
PkrI GCNGC 2 cut(s) 145, 209
PleI GAGTC 1 cut(s) 136
PpsI GAGTC 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 174
PspPI GGNCC 1 cut(s) 214
PsuI RGATCY 1 cut(s) 172
SaqAI TTAA 1 cut(s) 87
SatI GCNGC 2 cut(s) 144, 208
Sau3AI GATC 2 cut(s) 52, 172
Sau96I GGNCC 1 cut(s) 214
SchI GAGTC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 165
SetI ASST 4 cut(s) 22, 118, 127, 226
Sse9I AATT 1 cut(s) 29
SseBI AGGCCT 1 cut(s) 163
SspMI CTAG 1 cut(s) 96
StuI AGGCCT 1 cut(s) 163
StyD4I CCNGG 1 cut(s) 163
StyI CCWWGG 1 cut(s) 138
TaaI ACNGT 1 cut(s) 79
TasI AATT 1 cut(s) 29
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TseFI GTSAC 1 cut(s) 129
TseI GCWGC 2 cut(s) 143, 207
Tsp45I GTSAC 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 117
Van91I CCANNNNNTGG 1 cut(s) 32
XapI RAATTY 1 cut(s) 29
XcmI CCANNNNNNNNNTGG 1 cut(s) 195
XmiI GTMKAC 1 cut(s) 16
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.