Rh7DG257800

Cleavage site for pathogenic type III effector avirulence factor Avr

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0008210
Physical Location & Seq
Forward (+)
27033068 .. 27033249
182 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG257800.1

Sequence Viewer

Length: 182 bp
ATGGAAAATTTTACAATCCAACAAGAAAAGGGTAGGCCTCTCCCAAAAATTGGTGAATGGGATGTCAATGATCCTACTTCAACAGAAGGGTTTACTATGATCTTTGACAAGGCTAAGGATGAAAAGAAGACAGGTGGAAAACTTTATTTTGATGTTTTTGATTTATTGCTCAAGTTGTTTGG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

60

Amino Acids

6.97

Weight (kDa)

4.92

Isoelectric Point (pI)

16.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 9 - 43 1.4e-15 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 50
AclWI GGATC 1 cut(s) 65
AcsI RAATTY 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 50
AgsI TTSAA 1 cut(s) 81
AlwI GGATC 1 cut(s) 65
AoxI GGCC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 134
BpiI GAAGAC 1 cut(s) 134
Bpu10I CCTNAGC 1 cut(s) 114
BpuEI CTTGAG 1 cut(s) 155
Bsc4I CCNNNNNNNGG 1 cut(s) 50
BseGI GGATG 2 cut(s) 67, 124
BseLI CCNNNNNNNGG 1 cut(s) 50
BshFI GGCC 1 cut(s) 37
BslI CCNNNNNNNGG 1 cut(s) 50
BsnI GGCC 1 cut(s) 37
Bsp143I GATC 2 cut(s) 70, 99
BspANI GGCC 1 cut(s) 37
BspPI GGATC 1 cut(s) 65
BssMI GATC 2 cut(s) 70, 99
BstDEI CTNAG 1 cut(s) 114
BstF5I GGATG 2 cut(s) 67, 124
BstKTI GATC 2 cut(s) 73, 102
BstMBI GATC 2 cut(s) 70, 99
BstV2I GAAGAC 1 cut(s) 134
BsuRI GGCC 1 cut(s) 37
BtsCI GGATG 2 cut(s) 67, 124
CviJI RGCY 2 cut(s) 37, 113
CviKI_1 RGCY 2 cut(s) 37, 113
DdeI CTNAG 1 cut(s) 114
DpnI GATC 2 cut(s) 72, 101
DpnII GATC 2 cut(s) 70, 99
Eco147I AGGCCT 1 cut(s) 37
FaiI YATR 1 cut(s) 98
FokI GGATG 2 cut(s) 74, 131
HaeIII GGCC 1 cut(s) 37
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 93
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 114
Kzo9I GATC 2 cut(s) 70, 99
LpnPI CCDG 1 cut(s) 117
MalI GATC 2 cut(s) 72, 101
MboI GATC 2 cut(s) 70, 99
MboII GAAGA 1 cut(s) 139
MluCI AATT 2 cut(s) 7, 48
MmeI TCCRAC 1 cut(s) 43
MnlI CCTC 1 cut(s) 48
NdeII GATC 2 cut(s) 70, 99
PceI AGGCCT 1 cut(s) 37
PflMI CCANNNNNTGG 1 cut(s) 50
Sau3AI GATC 2 cut(s) 70, 99
SetI ASST 1 cut(s) 136
SgeI CNNG 3 cut(s) 35, 121, 144
SmlI CTYRAG 1 cut(s) 170
SmoI CTYRAG 1 cut(s) 170
Sse9I AATT 2 cut(s) 7, 48
SseBI AGGCCT 1 cut(s) 37
StuI AGGCCT 1 cut(s) 37
TasI AATT 2 cut(s) 7, 48
TspDTI ATGAA 1 cut(s) 135
Van91I CCANNNNNTGG 1 cut(s) 50
XapI RAATTY 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.