Rh5CG550000

Cleavage site for pathogenic type III effector avirulence factor Avr

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
76636186 .. 76639799
3614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG550000.1

Sequence Viewer

Length: 258 bp
ATGGGAAATTTTACTGATATCCAACAGGAAAAGGGTAGACCTCTCCCAAAATTTGGTGAATGGGATGTCAATGATCCTGCTTCAGCAGAAGGGTTTACTGTGATTTTTAACAAGGCTAGGGATGAAAAAAAGACAGGTGGCAAACCTGAGTCACCAACCAAGGCTGCTCAGAATAATGTCAGGCCTGGAGTGGATCCTAGCAGGCCACCATCTAAAAAATGGTTTTGCTGCATGGCCCAACCACCTACACAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.38

Weight (kDa)

9.06

Isoelectric Point (pI)

51.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 10 - 44 3.1e-20 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AccI GTMKAC 1 cut(s) 37
AclWI GGATC 3 cut(s) 68, 188, 201
AcsI RAATTY 2 cut(s) 7, 50
AcuI CTGAAG 1 cut(s) 66
AfiI CCNNNNNNNGG 1 cut(s) 53
AjnI CCWGG 1 cut(s) 184
AlwI GGATC 3 cut(s) 68, 188, 201
AoxI GGCC 3 cut(s) 182, 203, 234
ApeKI GCWGC 2 cut(s) 164, 228
ApoI RAATTY 2 cut(s) 7, 50
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 2 cut(s) 68, 144
BamHI GGATCC 1 cut(s) 193
BbvI GCAGC 2 cut(s) 151, 215
BccI CCATC 1 cut(s) 217
BciT130I CCWGG 1 cut(s) 186
BfaI CTAG 2 cut(s) 117, 198
BisI GCNGC 2 cut(s) 165, 229
BlsI GCNGC 2 cut(s) 166, 230
Bme1390I CCNGG 1 cut(s) 186
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 186
BpmI CTGGAG 1 cut(s) 207
BsaJI CCNNGG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 186
BseDI CCNNGG 1 cut(s) 159
BseGI GGATG 2 cut(s) 70, 127
BseLI CCNNNNNNNGG 1 cut(s) 53
BseMII CTCAG 2 cut(s) 138, 182
BseXI GCAGC 2 cut(s) 151, 215
BshFI GGCC 3 cut(s) 184, 205, 236
BslI CCNNNNNNNGG 1 cut(s) 53
BsnI GGCC 3 cut(s) 184, 205, 236
Bsp143I GATC 2 cut(s) 73, 193
BspANI GGCC 3 cut(s) 184, 205, 236
BspCNI CTCAG 2 cut(s) 139, 181
BspLI GGNNCC 1 cut(s) 195
BspPI GGATC 3 cut(s) 68, 188, 201
BssECI CCNNGG 1 cut(s) 159
BssMI GATC 2 cut(s) 73, 193
BssT1I CCWWGG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 100
BstC8I GCNNGC 1 cut(s) 203
BstDEI CTNAG 2 cut(s) 147, 168
BstF5I GGATG 2 cut(s) 70, 127
BstKTI GATC 2 cut(s) 76, 196
BstMBI GATC 2 cut(s) 73, 193
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstV1I GCAGC 2 cut(s) 151, 215
BstX2I RGATCY 1 cut(s) 193
BstYI RGATCY 1 cut(s) 193
BsuRI GGCC 3 cut(s) 184, 205, 236
BtsCI GGATG 2 cut(s) 70, 127
Cac8I GCNNGC 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 235
CviAII CATG 1 cut(s) 232
CviJI RGCY 5 cut(s) 116, 164, 184, 205, 236
CviKI_1 RGCY 5 cut(s) 116, 164, 184, 205, 236
DdeI CTNAG 2 cut(s) 147, 168
DpnI GATC 2 cut(s) 75, 195
DpnII GATC 2 cut(s) 73, 193
Eco130I CCWWGG 1 cut(s) 159
Eco147I AGGCCT 1 cut(s) 184
Eco32I GATATC 1 cut(s) 19
Eco57I CTGAAG 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 184
EcoRV GATATC 1 cut(s) 19
EcoT14I CCWWGG 1 cut(s) 159
ErhI CCWWGG 1 cut(s) 159
FaeI CATG 1 cut(s) 235
FaiI YATR 1 cut(s) 233
FatI CATG 1 cut(s) 231
FblI GTMKAC 1 cut(s) 37
Fnu4HI GCNGC 2 cut(s) 165, 229
FokI GGATG 2 cut(s) 77, 134
Fsp4HI GCNGC 2 cut(s) 165, 229
FspBI CTAG 2 cut(s) 117, 198
GluI GCNGC 2 cut(s) 165, 229
GsuI CTGGAG 1 cut(s) 207
HaeIII GGCC 3 cut(s) 184, 205, 236
Hin1II CATG 1 cut(s) 235
HinfI GANTC 1 cut(s) 149
HphI GGTGA 2 cut(s) 68, 144
Hpy166II GTNNAC 2 cut(s) 38, 96
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 1 cut(s) 255
Hpy8I GTNNAC 2 cut(s) 38, 96
HpyAV CCTTC 1 cut(s) 83
HpyCH4III ACNGT 1 cut(s) 100
HpyCH4V TGCA 1 cut(s) 231
HpyF3I CTNAG 2 cut(s) 147, 168
Hsp92II CATG 1 cut(s) 235
Kzo9I GATC 2 cut(s) 73, 193
LpnPI CCDG 8 cut(s) 11, 90, 120, 159, 166, 171, 187, 198
Lsp1109I GCAGC 2 cut(s) 151, 215
MaeI CTAG 2 cut(s) 117, 198
MaeIII GTNAC 1 cut(s) 150
MalI GATC 2 cut(s) 75, 195
MboI GATC 2 cut(s) 73, 193
MflI RGATCY 1 cut(s) 193
MluCI AATT 2 cut(s) 7, 50
MlyI GAGTC 1 cut(s) 158
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 1 cut(s) 51
MseI TTAA 1 cut(s) 108
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 2 cut(s) 73, 193
NlaIII CATG 1 cut(s) 235
NlaIV GGNNCC 1 cut(s) 195
NmuCI GTSAC 1 cut(s) 150
PceI AGGCCT 1 cut(s) 184
PflMI CCANNNNNTGG 1 cut(s) 53
PkrI GCNGC 2 cut(s) 166, 230
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 195
PspPI GGNCC 1 cut(s) 235
PsuI RGATCY 1 cut(s) 193
SaqAI TTAA 1 cut(s) 108
SatI GCNGC 2 cut(s) 165, 229
Sau3AI GATC 2 cut(s) 73, 193
Sau96I GGNCC 1 cut(s) 235
SchI GAGTC 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 186
SetI ASST 4 cut(s) 43, 139, 148, 247
Sse9I AATT 2 cut(s) 7, 50
SseBI AGGCCT 1 cut(s) 184
SspMI CTAG 2 cut(s) 117, 198
StuI AGGCCT 1 cut(s) 184
StyD4I CCNGG 1 cut(s) 184
StyI CCWWGG 1 cut(s) 159
TaaI ACNGT 1 cut(s) 100
TasI AATT 2 cut(s) 7, 50
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TseFI GTSAC 1 cut(s) 150
TseI GCWGC 2 cut(s) 164, 228
Tsp45I GTSAC 1 cut(s) 150
TspDTI ATGAA 1 cut(s) 138
Van91I CCANNNNNTGG 1 cut(s) 53
XapI RAATTY 2 cut(s) 7, 50
XcmI CCANNNNNNNNNTGG 1 cut(s) 216
XmiI GTMKAC 1 cut(s) 37
XspI CTAG 2 cut(s) 117, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.