pycom16g04970

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
3197828 .. 3198070
243 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 243 bp
ATGGAGGCACAAGAGAGAGAGGCTTGTGTGGATTCATTTTTGCCATCACCATCTCAAACAACCAAGTATTCATGGGAGTTCTCAAGATCCGTCGAAAACAACGTGATCTGGGTTTCCAAGTCTGATGAGATTCTTCTCGATCTCTGGAAGCCAGTTGTCAGGTACGAGTTTTCTCATCTCGTGACGACTTCAGGTCGTAAATTTCAATTCTCACCGGAATTCGGTGTGACGCTTCTGGCGTAG

Protein Analysis

81

Amino Acids

9.28

Weight (kDa)

5.0

Isoelectric Point (pI)

51.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 81
AcsI RAATTY 2 cut(s) 200, 218
AcuI CTGAAG 1 cut(s) 174
AfaI GTAC 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 221
AgsI TTSAA 1 cut(s) 206
AhdI GACNNNNNGTC 1 cut(s) 192
AlwI GGATC 1 cut(s) 81
ApoI RAATTY 2 cut(s) 200, 218
AsuHPI GGTGA 2 cut(s) 39, 204
BauI CACGAG 1 cut(s) 179
BccI CCATC 2 cut(s) 52, 58
BmeRI GACNNNNNGTC 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 67
BsaWI WCCGGW 1 cut(s) 214
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse1I ACTGG 1 cut(s) 152
BseLI CCNNNNNNNGG 1 cut(s) 221
BseNI ACTGG 1 cut(s) 152
BsiSI CCGG 1 cut(s) 215
BslI CCNNNNNNNGG 1 cut(s) 221
Bsp143I GATC 3 cut(s) 86, 105, 139
BspPI GGATC 1 cut(s) 81
BsrI ACTGG 1 cut(s) 152
BssMI GATC 3 cut(s) 86, 105, 139
BssSI CACGAG 1 cut(s) 179
Bst2BI CACGAG 1 cut(s) 179
BstKTI GATC 3 cut(s) 89, 108, 142
BstMBI GATC 3 cut(s) 86, 105, 139
BstX2I RGATCY 1 cut(s) 86
BstYI RGATCY 1 cut(s) 86
CseI GACGC 1 cut(s) 238
Csp6I GTAC 1 cut(s) 163
CviAII CATG 1 cut(s) 72
CviJI RGCY 2 cut(s) 23, 151
CviKI_1 RGCY 2 cut(s) 23, 151
CviQI GTAC 1 cut(s) 163
DpnI GATC 3 cut(s) 88, 107, 141
DpnII GATC 3 cut(s) 86, 105, 139
DriI GACNNNNNGTC 1 cut(s) 192
Eam1105I GACNNNNNGTC 1 cut(s) 192
Eco57I CTGAAG 1 cut(s) 174
EcoRI GAATTC 1 cut(s) 218
FaeI CATG 1 cut(s) 75
FaiI YATR 1 cut(s) 73
FatI CATG 1 cut(s) 71
HapII CCGG 1 cut(s) 215
HgaI GACGC 1 cut(s) 238
Hin1II CATG 1 cut(s) 75
HinfI GANTC 2 cut(s) 32, 130
HpaII CCGG 1 cut(s) 215
HphI GGTGA 2 cut(s) 39, 204
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 4 cut(s) 84, 137, 145, 181
Hpy99I CGWCG 1 cut(s) 95
HpyCH4IV ACGT 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 102
Hsp92II CATG 1 cut(s) 75
Kzo9I GATC 3 cut(s) 86, 105, 139
LpnPI CCDG 7 cut(s) 94, 130, 145, 165, 177, 221, 228
MaeII ACGT 1 cut(s) 102
MaeIII GTNAC 2 cut(s) 181, 226
MalI GATC 3 cut(s) 88, 107, 141
MboI GATC 3 cut(s) 86, 105, 139
MboII GAAGA 1 cut(s) 125
MflI RGATCY 1 cut(s) 86
MluCI AATT 3 cut(s) 200, 206, 218
MnlI CCTC 1 cut(s) 13
MspI CCGG 1 cut(s) 215
NdeII GATC 3 cut(s) 86, 105, 139
NlaIII CATG 1 cut(s) 75
NmuCI GTSAC 2 cut(s) 181, 226
PcsI WCGNNNNNNNCGW 2 cut(s) 99, 236
PfeI GAWTC 2 cut(s) 32, 130
PsuI RGATCY 1 cut(s) 86
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
Sau3AI GATC 3 cut(s) 86, 105, 139
SetI ASST 3 cut(s) 105, 164, 196
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 3 cut(s) 200, 206, 218
TaiI ACGT 1 cut(s) 105
TaqI TCGA 2 cut(s) 93, 138
TasI AATT 3 cut(s) 200, 206, 218
TfiI GAWTC 2 cut(s) 32, 130
TseFI GTSAC 2 cut(s) 181, 226
Tsp45I GTSAC 2 cut(s) 181, 226
TspDTI ATGAA 2 cut(s) 24, 60
TspGWI ACGGA 1 cut(s) 79
XapI RAATTY 2 cut(s) 200, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.