RchiOBHm_Chr7g0230941

MLP-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0017013
Physical Location & Seq
Forward (+)
54595998 .. 54596667
670 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGTTGTACACAGACCACACCATGTACCCAACAACAAACTTGATGGTGTTGCAACTAATCAAGCTGACAAGTCCTCATCCGCAAAAGTCGGTTCTATCTCATCCTGGAAGTATTTCCAAGATGGGAAAGCTAAAGTATCCCAGGAGATGATTGAAGCCCTGGACAGCAAGAAACATTCAGCAACTTGGAAAGTCGTTGAAGGAGAACTTCTTGATGATTACAAGAGCTTCAAGTTCATCCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

81

Amino Acids

9.09

Weight (kDa)

8.93

Isoelectric Point (pI)

26.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 2 - 80 1e-16 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 81
AfaI GTAC 2 cut(s) 9, 27
AgsI TTSAA 3 cut(s) 155, 200, 232
AjnI CCWGG 3 cut(s) 104, 141, 159
AluBI AGCT 3 cut(s) 65, 131, 228
AluI AGCT 3 cut(s) 65, 131, 228
Asp700I GAANNNNTTC 1 cut(s) 113
BccI CCATC 2 cut(s) 38, 116
BciT130I CCWGG 3 cut(s) 106, 143, 161
BciVI GTATCC 1 cut(s) 148
BfuI GTATCC 1 cut(s) 148
Bme1390I CCNGG 3 cut(s) 106, 143, 161
BmrFI CCNGG 3 cut(s) 106, 143, 161
BsaJI CCNNGG 2 cut(s) 141, 159
BseBI CCWGG 3 cut(s) 106, 143, 161
BseDI CCNNGG 2 cut(s) 141, 159
BseGI GGATG 3 cut(s) 77, 101, 237
Bsp1407I TGTACA 1 cut(s) 7
BspACI CCGC 1 cut(s) 81
BsrGI TGTACA 1 cut(s) 7
BssECI CCNNGG 2 cut(s) 141, 159
Bst2UI CCWGG 3 cut(s) 106, 143, 161
BstAUI TGTACA 1 cut(s) 7
BstF5I GGATG 3 cut(s) 77, 101, 237
BstNI CCWGG 3 cut(s) 106, 143, 161
BstSCI CCNGG 3 cut(s) 104, 141, 159
BsuI GTATCC 1 cut(s) 148
BtsCI GGATG 3 cut(s) 77, 101, 237
Csp6I GTAC 2 cut(s) 8, 26
CviAII CATG 1 cut(s) 23
CviJI RGCY 4 cut(s) 65, 131, 158, 228
CviKI_1 RGCY 4 cut(s) 65, 131, 158, 228
CviQI GTAC 2 cut(s) 8, 26
EcoRII CCWGG 3 cut(s) 104, 141, 159
FaeI CATG 1 cut(s) 26
FaiI YATR 1 cut(s) 24
FalI AAGNNNNNCTT 2 cut(s) 192, 224
FatI CATG 1 cut(s) 22
FokI GGATG 3 cut(s) 64, 88, 224
Hin1II CATG 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 212
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 194
HpyCH4V TGCA 1 cut(s) 53
Hsp92II CATG 1 cut(s) 26
LpnPI CCDG 6 cut(s) 91, 118, 128, 146, 155, 173
MnlI CCTC 1 cut(s) 85
MroXI GAANNNNTTC 1 cut(s) 113
MspR9I CCNGG 3 cut(s) 106, 143, 161
MvaI CCWGG 3 cut(s) 106, 143, 161
NlaIII CATG 1 cut(s) 26
PdmI GAANNNNTTC 1 cut(s) 113
PfoI TCCNGGA 1 cut(s) 104
Psp6I CCWGG 3 cut(s) 104, 141, 159
PspGI CCWGG 3 cut(s) 104, 141, 159
RsaI GTAC 2 cut(s) 9, 27
RsaNI GTAC 2 cut(s) 8, 26
ScrFI CCNGG 3 cut(s) 106, 143, 161
SetI ASST 3 cut(s) 67, 133, 230
SsiI CCGC 1 cut(s) 81
StyD4I CCNGG 3 cut(s) 104, 141, 159
TatI WGTACW 1 cut(s) 7
TspDTI ATGAA 1 cut(s) 226
XmnI GAANNNNTTC 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.