RLG00000001440

MLP-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0017013
Physical Location & Seq
Reverse (-)
15659726 .. 15660270
545 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001440

Sequence Viewer

Length: 432 bp
ATGTCCAATTATGGTAAGGTGGAGGTGGCTATTGAGATCAAGGCTGGTGCTGACGAGTTCTATGATATGGTCGTACACAGACCACACCATGTACCCAACAACAGACTTGATGGTGTTGCAACCAATCAAGCTGACAAGTCCTCATCAGCAAAAGTCGGTTCTATCTCATCCTGGAAGTATTTCCAAGCCCTGGACAGCAAGAAACATTCAGCAACTTGGAAAGTCGTTGAAGGAGAACTTCTTGATGATTACAAGAGCTTCAAGTTCATCCTGCAAATTATTGCCACTCCAAACCCGAAAGCAACGGTGCATGTGATTTTGGAGTATGAGAAGATGCATGACGATGTTGCAGACCCATATTTTATGCTCCAGGCGGTAACTGTTAACATCAAGGGCGTCGATGCTCAACTATACACTCAGAGCAGGACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

144

Amino Acids

16.09

Weight (kDa)

6.28

Isoelectric Point (pI)

34.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 5 - 138 1.6e-21 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 190
AciI CCGC 1 cut(s) 374
AcyI GRCGYC 1 cut(s) 396
AfaI GTAC 2 cut(s) 75, 93
AfiI CCNNNNNNNGG 1 cut(s) 190
AgsI TTSAA 2 cut(s) 230, 262
AjnI CCWGG 3 cut(s) 170, 189, 369
AluBI AGCT 2 cut(s) 131, 258
AluI AGCT 2 cut(s) 131, 258
AlwNI CAGNNNCTG 1 cut(s) 429
Asp700I GAANNNNTTC 1 cut(s) 179
AspS9I GGNCC 1 cut(s) 426
AvaII GGWCC 1 cut(s) 426
BccI CCATC 1 cut(s) 104
BciT130I CCWGG 3 cut(s) 172, 191, 371
Bme1390I CCNGG 3 cut(s) 172, 191, 371
Bme18I GGWCC 1 cut(s) 426
BmgT120I GGNCC 1 cut(s) 426
BmrFI CCNGG 3 cut(s) 172, 191, 371
BmsI GCATC 2 cut(s) 324, 391
BpmI CTGGAG 1 cut(s) 353
BsaHI GRCGYC 1 cut(s) 396
BsaJI CCNNGG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 190
BseBI CCWGG 3 cut(s) 172, 191, 371
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 2 cut(s) 167, 267
BseLI CCNNNNNNNGG 1 cut(s) 190
BseMII CTCAG 1 cut(s) 431
BslI CCNNNNNNNGG 1 cut(s) 190
Bsp143I GATC 1 cut(s) 36
BspACI CCGC 1 cut(s) 374
BspCNI CTCAG 1 cut(s) 430
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 1 cut(s) 36
BssNI GRCGYC 1 cut(s) 396
Bst2UI CCWGG 3 cut(s) 172, 191, 371
Bst4CI ACNGT 2 cut(s) 307, 382
BstACI GRCGYC 1 cut(s) 396
BstDEI CTNAG 1 cut(s) 417
BstF5I GGATG 2 cut(s) 167, 267
BstKTI GATC 1 cut(s) 39
BstMBI GATC 1 cut(s) 36
BstNI CCWGG 3 cut(s) 172, 191, 371
BstNSI RCATGY 1 cut(s) 314
BstSCI CCNGG 3 cut(s) 170, 189, 369
BtsCI GGATG 2 cut(s) 167, 267
CaiI CAGNNNCTG 1 cut(s) 429
Cfr13I GGNCC 1 cut(s) 426
CseI GACGC 1 cut(s) 385
Csp6I GTAC 2 cut(s) 74, 92
CviAII CATG 3 cut(s) 89, 311, 338
CviJI RGCY 5 cut(s) 29, 44, 131, 188, 258
CviKI_1 RGCY 5 cut(s) 29, 44, 131, 188, 258
CviQI GTAC 2 cut(s) 74, 92
DdeI CTNAG 1 cut(s) 417
DpnI GATC 1 cut(s) 38
DpnII GATC 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 426
EcoO109I RGGNCCY 1 cut(s) 426
EcoRII CCWGG 3 cut(s) 170, 189, 369
EcoT22I ATGCAT 1 cut(s) 339
FaeI CATG 3 cut(s) 92, 314, 341
FalI AAGNNNNNCTT 2 cut(s) 222, 254
FatI CATG 3 cut(s) 88, 310, 337
FokI GGATG 2 cut(s) 154, 254
GsuI CTGGAG 1 cut(s) 353
HgaI GACGC 1 cut(s) 385
Hin1I GRCGYC 1 cut(s) 396
Hin1II CATG 3 cut(s) 92, 314, 341
HincII GTYRAC 1 cut(s) 385
HindII GTYRAC 1 cut(s) 385
HpaI GTTAAC 1 cut(s) 385
Hpy166II GTNNAC 2 cut(s) 76, 385
Hpy188I TCNGA 1 cut(s) 420
Hpy188III TCNNGA 1 cut(s) 242
Hpy8I GTNNAC 2 cut(s) 76, 385
Hpy99I CGWCG 1 cut(s) 401
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 2 cut(s) 307, 382
HpyCH4V TGCA 5 cut(s) 119, 274, 310, 337, 350
HpyF3I CTNAG 1 cut(s) 417
Hsp92I GRCGYC 1 cut(s) 396
Hsp92II CATG 3 cut(s) 92, 314, 341
KspAI GTTAAC 1 cut(s) 385
Kzo9I GATC 1 cut(s) 36
LmnI GCTCC 1 cut(s) 372
LpnPI CCDG 9 cut(s) 30, 157, 176, 184, 203, 284, 356, 383, 409
LweI GCATC 2 cut(s) 324, 391
MaeIII GTNAC 1 cut(s) 376
MalI GATC 1 cut(s) 38
MboI GATC 1 cut(s) 36
MboII GAAGA 1 cut(s) 343
MluCI AATT 2 cut(s) 7, 276
MnlI CCTC 2 cut(s) 16, 151
Mph1103I ATGCAT 1 cut(s) 339
MroXI GAANNNNTTC 1 cut(s) 179
MseI TTAA 1 cut(s) 384
MslI CAYNNNNRTG 1 cut(s) 342
MspR9I CCNGG 3 cut(s) 172, 191, 371
MvaI CCWGG 3 cut(s) 172, 191, 371
NdeII GATC 1 cut(s) 36
NlaIII CATG 3 cut(s) 92, 314, 341
NsiI ATGCAT 1 cut(s) 339
NspI RCATGY 1 cut(s) 314
PdmI GAANNNNTTC 1 cut(s) 179
PflMI CCANNNNNTGG 1 cut(s) 190
PfoI TCCNGGA 1 cut(s) 170
PpuMI RGGWCCY 1 cut(s) 426
Psp5II RGGWCCY 1 cut(s) 426
Psp6I CCWGG 3 cut(s) 170, 189, 369
PspGI CCWGG 3 cut(s) 170, 189, 369
PspPI GGNCC 1 cut(s) 426
PspPPI RGGWCCY 1 cut(s) 426
PstNI CAGNNNCTG 1 cut(s) 429
RsaI GTAC 2 cut(s) 75, 93
RsaNI GTAC 2 cut(s) 74, 92
RseI CAYNNNNRTG 1 cut(s) 342
SaqAI TTAA 1 cut(s) 384
Sau3AI GATC 1 cut(s) 36
Sau96I GGNCC 1 cut(s) 426
ScrFI CCNGG 3 cut(s) 172, 191, 371
SetI ASST 5 cut(s) 21, 27, 133, 260, 431
SfaNI GCATC 2 cut(s) 324, 391
SinI GGWCC 1 cut(s) 426
SmiMI CAYNNNNRTG 1 cut(s) 342
Sse9I AATT 2 cut(s) 7, 276
SsiI CCGC 1 cut(s) 374
StyD4I CCNGG 3 cut(s) 170, 189, 369
TaaI ACNGT 2 cut(s) 307, 382
TaqI TCGA 1 cut(s) 399
TasI AATT 2 cut(s) 7, 276
Tru1I TTAA 1 cut(s) 384
Tru9I TTAA 1 cut(s) 384
TspDTI ATGAA 1 cut(s) 256
Van91I CCANNNNNTGG 1 cut(s) 190
VpaK11BI GGWCC 1 cut(s) 426
XceI RCATGY 1 cut(s) 314
XmnI GAANNNNTTC 1 cut(s) 179
Zsp2I ATGCAT 1 cut(s) 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.