RchiOBHm_Chr5g0024421

Belongs to the 14-3-3 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
18566878 .. 18567739
862 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 531 bp
ATGAAGATGGTTGCAAATCTTGATAATGTTGTTGATGCTCGGAGATCATCATGGAGGATCTTATCATCAGCAGAGCTGACGGAGGAGGCGAAAGGAAATAATATTCACCTGAAGCATCTAAAAACATATAGACAGAGAGTTGAATCAGAGATATCAATTATTTGTAGAGATATCATCTCAGTGCTTGATAGTCATCTCATCCCTTCGACTTCAGATGGTGAATCAACTGTGCATTATCATAAGATGAAAGGAGACTTTTATAGGTATCTCGCAGAAATCAAGGCCGGTGATGAGAAAGAGGAGGCTATCGAACAGTCGAAGAAAGCATATTACAAGGCCCTCACTGTTGCAGAAGTTAAGTTGCCTCCTACAAATCCCATCCAGACGGCCTGCCGTCTTACAAAGATAGCTTTTAAGGAAGGCACTCCTGAGATTAACACATTGAACAATGAACCATACAAGAATACCCTCATGGCCTTGAAACTTTTAAGGGAAAACTACAGCTTGTGGACTTCCCAACTTCCACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

176

Amino Acids

20.15

Weight (kDa)

8.43

Isoelectric Point (pI)

52.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
14-3-3 PF00244 7 - 128 5.8e-41 14-3-3 protein
14-3-3 PF00244 128 - 171 1.4e-06 14-3-3 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018612)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 65
AcuI CTGAAG 2 cut(s) 131, 195
AgsI TTSAA 3 cut(s) 143, 445, 481
AluBI AGCT 3 cut(s) 76, 410, 504
AluI AGCT 3 cut(s) 76, 410, 504
Alw26I GTCTC 1 cut(s) 246
AlwI GGATC 1 cut(s) 65
AoxI GGCC 4 cut(s) 282, 336, 387, 474
AspS9I GGNCC 1 cut(s) 337
AsuHPI GGTGA 3 cut(s) 98, 230, 299
BccI CCATC 2 cut(s) 209, 386
BceAI ACGGC 2 cut(s) 378, 402
BcoDI GTCTC 1 cut(s) 246
BfmI CTRYAG 1 cut(s) 499
BmgT120I GGNCC 1 cut(s) 337
BmsI GCATC 2 cut(s) 25, 124
BsaBI GATNNNNATC 1 cut(s) 192
Bse118I RCCGGY 1 cut(s) 284
Bse8I GATNNNNATC 1 cut(s) 192
BseGI GGATG 2 cut(s) 198, 378
BseJI GATNNNNATC 1 cut(s) 192
BseMII CTCAG 2 cut(s) 192, 420
BseRI GAGGAG 2 cut(s) 98, 314
BshFI GGCC 4 cut(s) 284, 338, 389, 476
BsiSI CCGG 1 cut(s) 285
BsmAI GTCTC 1 cut(s) 246
BsnI GGCC 4 cut(s) 284, 338, 389, 476
Bsp143I GATC 2 cut(s) 44, 57
BspANI GGCC 4 cut(s) 284, 338, 389, 476
BspCNI CTCAG 2 cut(s) 191, 421
BspPI GGATC 1 cut(s) 65
BsrFI RCCGGY 1 cut(s) 284
BssAI RCCGGY 1 cut(s) 284
BssMI GATC 2 cut(s) 44, 57
Bst4CI ACNGT 3 cut(s) 229, 315, 346
BstC8I GCNNGC 1 cut(s) 391
BstDEI CTNAG 2 cut(s) 178, 429
BstF5I GGATG 2 cut(s) 198, 378
BstKTI GATC 2 cut(s) 47, 60
BstMAI GTCTC 1 cut(s) 246
BstMBI GATC 2 cut(s) 44, 57
BstSFI CTRYAG 1 cut(s) 499
BstX2I RGATCY 1 cut(s) 57
BstYI RGATCY 1 cut(s) 57
BsuRI GGCC 4 cut(s) 284, 338, 389, 476
BtsCI GGATG 2 cut(s) 198, 378
BtsIMutI CAGTG 2 cut(s) 186, 342
Cac8I GCNNGC 1 cut(s) 391
Cfr10I RCCGGY 1 cut(s) 284
Cfr13I GGNCC 1 cut(s) 337
CviAII CATG 2 cut(s) 51, 472
CviJI RGCY 8 cut(s) 76, 284, 305, 338, 389, 410, 476, 504
CviKI_1 RGCY 8 cut(s) 76, 284, 305, 338, 389, 410, 476, 504
DdeI CTNAG 2 cut(s) 178, 429
DpnI GATC 2 cut(s) 46, 59
DpnII GATC 2 cut(s) 44, 57
Eco32I GATATC 2 cut(s) 153, 172
Eco57I CTGAAG 2 cut(s) 131, 195
EcoO109I RGGNCCY 1 cut(s) 337
EcoRV GATATC 2 cut(s) 153, 172
FaeI CATG 2 cut(s) 54, 475
FaiI YATR 8 cut(s) 52, 127, 129, 240, 261, 328, 457, 473
FatI CATG 2 cut(s) 50, 471
FokI GGATG 2 cut(s) 185, 365
HaeIII GGCC 4 cut(s) 284, 338, 389, 476
HapII CCGG 1 cut(s) 285
Hin1II CATG 2 cut(s) 54, 475
HinfI GANTC 2 cut(s) 143, 221
HpaII CCGG 1 cut(s) 285
HphI GGTGA 3 cut(s) 98, 230, 299
Hpy166II GTNNAC 1 cut(s) 510
Hpy188I TCNGA 3 cut(s) 42, 148, 214
Hpy188III TCNNGA 3 cut(s) 20, 382, 428
Hpy8I GTNNAC 1 cut(s) 510
HpyAV CCTTC 2 cut(s) 213, 413
HpyCH4III ACNGT 3 cut(s) 229, 315, 346
HpyCH4V TGCA 3 cut(s) 14, 232, 350
HpyF3I CTNAG 2 cut(s) 178, 429
Hsp92II CATG 2 cut(s) 54, 475
Kzo9I GATC 2 cut(s) 44, 57
LpnPI CCDG 5 cut(s) 122, 298, 395, 403, 441
LweI GCATC 2 cut(s) 25, 124
MalI GATC 2 cut(s) 46, 59
MboI GATC 2 cut(s) 44, 57
MboII GAAGA 2 cut(s) 16, 331
MflI RGATCY 1 cut(s) 57
MluCI AATT 1 cut(s) 156
MnlI CCTC 8 cut(s) 48, 76, 79, 292, 295, 350, 375, 479
MseI TTAA 5 cut(s) 357, 414, 435, 488, 529
MslI CAYNNNNRTG 1 cut(s) 179
MspI CCGG 1 cut(s) 285
NdeII GATC 2 cut(s) 44, 57
NlaIII CATG 2 cut(s) 54, 475
PcsI WCGNNNNNNNCGW 1 cut(s) 86
PfeI GAWTC 2 cut(s) 143, 221
PspPI GGNCC 1 cut(s) 337
PsuI RGATCY 1 cut(s) 57
RseI CAYNNNNRTG 1 cut(s) 179
SaqAI TTAA 5 cut(s) 357, 414, 435, 488, 529
Sau3AI GATC 2 cut(s) 44, 57
Sau96I GGNCC 1 cut(s) 337
SetI ASST 5 cut(s) 78, 111, 266, 412, 506
SfaNI GCATC 2 cut(s) 25, 124
SfcI CTRYAG 1 cut(s) 499
SmiMI CAYNNNNRTG 1 cut(s) 179
Sse9I AATT 1 cut(s) 156
SspI AATATT 1 cut(s) 103
TaaI ACNGT 3 cut(s) 229, 315, 346
TaqI TCGA 3 cut(s) 206, 309, 317
TasI AATT 1 cut(s) 156
TfiI GAWTC 2 cut(s) 143, 221
Tru1I TTAA 5 cut(s) 357, 414, 435, 488, 529
Tru9I TTAA 5 cut(s) 357, 414, 435, 488, 529
TscAI CASTG 2 cut(s) 186, 349
TspDTI ATGAA 3 cut(s) 17, 260, 465
TspGWI ACGGA 1 cut(s) 95
TspRI CASTG 2 cut(s) 186, 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.