RchiOBHm_Chr5g0048851

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
46221369 .. 46224692
3324 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGGTTGTGATAAATTTAGGACCTATTGAATGTATACCCTTTCAGAGGGACGTAAATCTGCTAGCTAATCCAGATAAGTATGCTGAATTCCCAAATCAATTGGCACAGTCATTCAACTCCAAGCTAAGGACCAATATAATGAGCCTTAGAATCTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.95

Weight (kDa)

7.93

Isoelectric Point (pI)

64.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018102)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 157
AccI GTMKAC 1 cut(s) 34
AcsI RAATTY 2 cut(s) 13, 86
AfiI CCNNNNNNNGG 2 cut(s) 45, 126
AgsI TTSAA 2 cut(s) 29, 115
AluBI AGCT 2 cut(s) 65, 124
AluI AGCT 2 cut(s) 65, 124
ApoI RAATTY 2 cut(s) 13, 86
AspS9I GGNCC 2 cut(s) 20, 129
AsuNHI GCTAGC 1 cut(s) 61
AvaII GGWCC 2 cut(s) 20, 129
BfaI CTAG 1 cut(s) 62
Bme18I GGWCC 2 cut(s) 20, 129
BmgT120I GGNCC 2 cut(s) 20, 129
BmtI GCTAGC 1 cut(s) 65
Bpu10I CCTNAGC 1 cut(s) 125
Bsc4I CCNNNNNNNGG 2 cut(s) 45, 126
BseLI CCNNNNNNNGG 2 cut(s) 45, 126
BslFI GGGAC 1 cut(s) 62
BslI CCNNNNNNNGG 2 cut(s) 45, 126
BsmFI GGGAC 1 cut(s) 62
BspOI GCTAGC 1 cut(s) 65
BssNAI GTATAC 1 cut(s) 35
Bst1107I GTATAC 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 63
BstDEI CTNAG 2 cut(s) 125, 146
BstENI CCTNNNNNAGG 1 cut(s) 43
BstZ17I GTATAC 1 cut(s) 35
Cac8I GCNNGC 1 cut(s) 63
Cfr13I GGNCC 2 cut(s) 20, 129
CviJI RGCY 3 cut(s) 65, 124, 144
CviKI_1 RGCY 3 cut(s) 65, 124, 144
DdeI CTNAG 2 cut(s) 125, 146
Eco47I GGWCC 2 cut(s) 20, 129
EcoNI CCTNNNNNAGG 1 cut(s) 43
EcoO109I RGGNCCY 1 cut(s) 20
EcoRI GAATTC 1 cut(s) 86
FaiI YATR 4 cut(s) 35, 81, 137, 157
FaqI GGGAC 1 cut(s) 62
FblI GTMKAC 1 cut(s) 34
FspBI CTAG 1 cut(s) 62
HinfI GANTC 1 cut(s) 150
Hpy166II GTNNAC 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 71
Hpy8I GTNNAC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 108
HpyCH4IV ACGT 1 cut(s) 51
HpyF3I CTNAG 2 cut(s) 125, 146
HpySE526I ACGT 1 cut(s) 51
LpnPI CCDG 1 cut(s) 84
MaeI CTAG 1 cut(s) 62
MaeII ACGT 1 cut(s) 51
MfeI CAATTG 1 cut(s) 98
MluCI AATT 3 cut(s) 13, 86, 98
MnlI CCTC 1 cut(s) 39
MunI CAATTG 1 cut(s) 98
NheI GCTAGC 1 cut(s) 61
PfeI GAWTC 1 cut(s) 150
PpuMI RGGWCCY 1 cut(s) 20
PsiI TTATAA 1 cut(s) 157
Psp5II RGGWCCY 1 cut(s) 20
PspPI GGNCC 2 cut(s) 20, 129
PspPPI RGGWCCY 1 cut(s) 20
Sau96I GGNCC 2 cut(s) 20, 129
SetI ASST 4 cut(s) 25, 54, 67, 126
SgeI CNNG 3 cut(s) 74, 83, 133
SinI GGWCC 2 cut(s) 20, 129
Sse9I AATT 3 cut(s) 13, 86, 98
SspMI CTAG 1 cut(s) 62
TaaI ACNGT 1 cut(s) 108
TaiI ACGT 1 cut(s) 54
TasI AATT 3 cut(s) 13, 86, 98
TfiI GAWTC 1 cut(s) 150
VpaK11BI GGWCC 2 cut(s) 20, 129
XagI CCTNNNNNAGG 1 cut(s) 43
XapI RAATTY 2 cut(s) 13, 86
XmiI GTMKAC 1 cut(s) 34
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.