RchiOBHm_Chr5g0046511

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
42564527 .. 42565003
477 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32450

Sequence Viewer

Length: 210 bp
ATGATGAGAAATACAAGACTATACAAATTTGGGTGCAACTGTGCAAAGAAGATGGTTGTGATAAATTTAGGACCTATTGAATGTATACCCTTTCAGAGGGAAGTAAATCTGCTAGCTAATCCAGATAAGTATGCTGAATTCCCAAATCAATTGGCACAGTCATTCAACTCCAAGCTAAGGACCAACATAATGAGCCTTAGAATCTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.01

Weight (kDa)

9.73

Isoelectric Point (pI)

54.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018102)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 208
AccI GTMKAC 1 cut(s) 85
AcsI RAATTY 3 cut(s) 26, 64, 137
AfiI CCNNNNNNNGG 2 cut(s) 96, 177
AgsI TTSAA 2 cut(s) 80, 166
AluBI AGCT 2 cut(s) 116, 175
AluI AGCT 2 cut(s) 116, 175
ApoI RAATTY 3 cut(s) 26, 64, 137
AspS9I GGNCC 2 cut(s) 71, 180
AsuNHI GCTAGC 1 cut(s) 112
AvaII GGWCC 2 cut(s) 71, 180
BccI CCATC 1 cut(s) 46
BfaI CTAG 1 cut(s) 113
Bme18I GGWCC 2 cut(s) 71, 180
BmgT120I GGNCC 2 cut(s) 71, 180
BmtI GCTAGC 1 cut(s) 116
Bpu10I CCTNAGC 1 cut(s) 176
Bsc4I CCNNNNNNNGG 2 cut(s) 96, 177
BseLI CCNNNNNNNGG 2 cut(s) 96, 177
BslI CCNNNNNNNGG 2 cut(s) 96, 177
BspOI GCTAGC 1 cut(s) 116
BssNAI GTATAC 1 cut(s) 86
Bst1107I GTATAC 1 cut(s) 86
Bst4CI ACNGT 2 cut(s) 41, 159
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 2 cut(s) 176, 197
BstENI CCTNNNNNAGG 1 cut(s) 94
BstZ17I GTATAC 1 cut(s) 86
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 71, 180
CviJI RGCY 3 cut(s) 116, 175, 195
CviKI_1 RGCY 3 cut(s) 116, 175, 195
DdeI CTNAG 2 cut(s) 176, 197
Eco47I GGWCC 2 cut(s) 71, 180
EcoNI CCTNNNNNAGG 1 cut(s) 94
EcoO109I RGGNCCY 1 cut(s) 71
EcoRI GAATTC 1 cut(s) 137
FaiI YATR 5 cut(s) 22, 86, 132, 188, 208
FblI GTMKAC 1 cut(s) 85
FspBI CTAG 1 cut(s) 113
HinfI GANTC 1 cut(s) 201
Hpy166II GTNNAC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 1 cut(s) 86
HpyCH4III ACNGT 2 cut(s) 41, 159
HpyCH4V TGCA 2 cut(s) 36, 44
HpyF3I CTNAG 2 cut(s) 176, 197
LpnPI CCDG 1 cut(s) 135
MaeI CTAG 1 cut(s) 113
MboII GAAGA 1 cut(s) 61
MfeI CAATTG 1 cut(s) 149
MluCI AATT 4 cut(s) 26, 64, 137, 149
MnlI CCTC 1 cut(s) 90
MunI CAATTG 1 cut(s) 149
NheI GCTAGC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 201
PpuMI RGGWCCY 1 cut(s) 71
PsiI TTATAA 1 cut(s) 208
Psp5II RGGWCCY 1 cut(s) 71
PspPI GGNCC 2 cut(s) 71, 180
PspPPI RGGWCCY 1 cut(s) 71
Sau96I GGNCC 2 cut(s) 71, 180
SetI ASST 3 cut(s) 76, 118, 177
SgeI CNNG 4 cut(s) 27, 125, 134, 184
SinI GGWCC 2 cut(s) 71, 180
Sse9I AATT 4 cut(s) 26, 64, 137, 149
SspMI CTAG 1 cut(s) 113
TaaI ACNGT 2 cut(s) 41, 159
TasI AATT 4 cut(s) 26, 64, 137, 149
TfiI GAWTC 1 cut(s) 201
VpaK11BI GGWCC 2 cut(s) 71, 180
XagI CCTNNNNNAGG 1 cut(s) 94
XapI RAATTY 3 cut(s) 26, 64, 137
XmiI GTMKAC 1 cut(s) 85
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.